a portion of the script pane shows just the onmousemove handler for the slider movie clip the global coordinates of mypoint mypoint x and mypoint y change to the local coordinates of the groove movie clip
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx
... Sata, F., Katakura, F., Urashima, Y. , Hatakeyama, A. , Kobayashi, S., Jin, K., Kurahashi, N., Kondo, T., Gong, Y Y and Umemura, T (2004) Symptoms in relation to chemicals and dampness in newly ... Health Organization, Geneva 84) Saijo, Y. , Kishi, Y. , Sata, F., Katakura, Y. , Urashima, Y. , Hatakeyama, A. , Kobayashi, S., Jin, K., Kurahashi, N., Kondo, T., Gong, Y Y and Umemura, T (2004) Symptoms ... rather because of psychological or mental factors) and type (symptoms developed due to allergies).22) Imai et al identified the psychosocial aggravating factors of SHS.23) The Japanese Society...
- 14
- 940
- 1
Next Generation Connectivity: A review of broadband Internet transitions and policy from around the world pdf
... European countries, and on the Netherlands and Canada for fixed, positively, and for 3G, negatively, and vice versa for Italy and Spain Table 3.2 provides an at -a- glance report of these various measures, ... Korea Iceland Netherlands Denmark Japan Norway Sweden Canada Finland Luxembourg United Kingdom Belgium Switzerland United States Germany Austria Australia France Spain New Zealand Hungary Ireland ... penetration and price, and actual measurements of speed and latency, in the case of capacity We describe these data alongside other sources of data, most extensively OECD data, and correlate the data from...
- 232
- 669
- 0
A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx
... capital assets and the extent to which they are interchangeable For example, natural capital may be the basis for financial capital (land as collateral that can be used to obtain a loan) Or natural ... 42 Appendix Box A5 : Example of how changes in assets can be analysed and presented Natural capital Social capital Physical capital Financial capital Human capital Vulnerability prices may have ... different area or family are disadvantaged, as they have to work their way in and probably have to learn the hard way, by learning from their mistakes The SLA embraces a wider approach to people’s...
- 95
- 645
- 0
CrazY ''''08 How a Cast of Cranks, Rogues, Boneheads, and Magnates Created the Greatest Year in Baseball History ppt
... be one of the premier managers in the game “He would take kids out of the coal mines and out of the wheat fields and make them walk and talk and chatter and play ball with the look of eagles,”47sportswriter ... than the average player, by a good inch -and -a- half and almost ten pounds.26 They are also very, very good, with a vast armory of weapons at their disposal The curveball was discovered not long after ... CAIT MURPHY CrazY '08 How a Cast of Cranks, Rogues, Boneheads, and Magnates Created the Greatest Year in Baseball History o my two biggest fans: my father and mother So grandly contested...
- 398
- 194
- 0
Báo cáo lâm nghiệp: "Variation in the composition and content of ellagitannins in the heartwood of European oaks (Quercus robur and Q petraea). A comparison of two French forests and variation with heartwood age" ppt
... from the Limousin is also apparent and the data were log-transformed, resulting in more homogeneous variances A balanced, nested analysis of variance was used to compare the variation between and ... trees and samples was found for all three variables Variance components (see table III) show that the between-forest variation accounted for a relatively small amount of the total variation of wood ... the heartwood age; T is the a concentration of ellagitannins at age a and oh T where a = This gives an estimate for b of -0.0219 with a standard error of 0.0007 and an R of 0.988 Therefore, if...
- 14
- 384
- 0
Báo cáo y học: " Initiation of bacteriophage T4 DNA replication and replication fork dynamics: a review in the Virology Journal series on bacteriophage T4 and its relatives" pptx
... of the National Academy of Sciences of the United States of America 1980, 77:2450-2454 41 Xu BJ, Clayton DA: RNA-DNA hybrid formation at the human mitochondrial heavy- strand origin ceases at ... bubble-migration synthesis, lagging strand synthesis does not occur, and the newly synthesized single strand is extruded from the back of the D-loop as new DNA is synthesized at the front of the D-loop (panel ... mechanisms for initiation of DNA replication forks in bacteriophage T4: Priming by RNA polymerase and by recombination Proceedings of the National Academy of Sciences of the United States of America 1982,...
- 16
- 389
- 0
Báo cáo y học: " Structural analysis of bacteriophage T4 DNA replication: a review in the Virology Journal series on bacteriophage T4 and its relatives" pptx
... screens and other tools for the preparation, handling, and cryogenic preservation of crystals, along with webbased advice The computational aspects of crystallography are simplified and can operate ... ligase has lower affinity for DNA than the multidomain ligases The lack of additional domains to encompass the duplex DNA likely explains the sensitivity of T4 ligase activity to salt concentration ... here a summary of our collaborative efforts with the late Dr Nossal, and also the work of many others, that, in total, has created a pictorial view of prokaryotic DNA replication A list of proteins...
- 17
- 364
- 0
Báo cáo y học: "Mutagenesis of tyrosine and di-leucine motifs in the HIV-1 envelope cytoplasmic domain results in a loss of Env-mediated fusion and infectivi" pps
... Y7 95S/LL799HQ /Y8 02SRP - 5’CCTGACTCCAAGACTGTTGGTGATTCCACCAAGATTTGAGGGCTTCC3’, LL814AAFP - 5’GC TGTTAACGCGGCCAATGCCAATGCCACAGC3’, LL814AARP - 5’GGCATTGGCCGCGT TAACAGCACTATTC3’, LL855AAFP - 5’GGGCTTGGAAAGGATTGCGGCATAAGATGGG3’, ... may reflect altered intracellular trafficking of Env and an inability of Env and Gag to be directed to a common site for assembly Env clearly has the capacity to redirect where virus assembly ... was determined by calculating the ratio of gp120 and gp41 to p24 Acknowledgements We thank Cynthia Derdeyn, Lara Pereira, and Malinda Schaeffer for critical review of the manuscript We are grateful...
- 17
- 362
- 0
A review of lean six sigma and malcolm baldrige national quality award and a proposal for the future
... respectively Table 4.1 Comparing Lean Six Sigma and Malcolm Baldrige National Quality Award on a Conceptual Basis Areas of Comparison Lean Six Sigma Malcolm Baldrige National Quality Award Fundamental ... existing quality factors that LSS and MBNQA affects and the list of quality factors which are deemed to be essential to helping a company increase its competitive advantage The factors that are ... guiding an organization to improve on their level of quality Examples of these key frameworks are Lean, Six Sigma, Total Quality Management, ISO and MBNQA For the purpose of our research, a literature...
- 83
- 361
- 0
A STUDY ON THE ADVERB ZAI SINCE LATE QING DYNASTY AND EARLY REPUBLIC OF CHINA
... linguistics and he helped me a lot I was very lucky that lots of teachers made me feel warm I want to say thank you to Prof SONG Yayun, Prof JIANG Fang and so on My friends made me happy and encouraged ... in late Qing Dynasty and early Republic of China But we can find an increasing trend of "zai VP" in 1940s The adverb "zai " in Nanking mandarin has influenced standard Chinese, and then standard ... IV A study on the advervb "zai" since late Qing Dynasty and early Republic of China Kuang Taoqun (mandarin Chinese grammar) Directed by Professor Guo Rui Abstract "Zai" wasn’t used as an adverb...
- 77
- 462
- 0
“Good” Legislation as a Means of Ensuring Voice, Accountability, and the Delivery of Results in Urban Development
... the delivery of results Assessing the impact of legislation through an analysis of the problem to be addressed, the examination of available policy or legislative options, and the appraisal of ... ways or not at all that make understanding and interpretation complicated Drafting guidelines can help standardize, simplify, and clarify the language of the texts, facilitating their understanding ... obligations of all social actors, but also in allowing these rights and obligations to be enforced and honored Improve the Clarity and Accessibility of the Law As a binding expression of the rights and...
- 14
- 355
- 0
A study of comforting in english and vietnamese
... IMPLICATIONS 5.1 A SUMMARY OF THE STUDY After selecting and classifying the data into categories that are set in the outline, we described, analyzed and made a contrastive analysis to clarify the ... Positive and Negative Politeness maxims (tact maxim, generosity maxim, approbation maxim, modesty Brown and Levinson [13, p.130] assert: "Negative politeness maxim, meta maxim, agreement maxim and sympathy ... results of analysis above, compare the contrastive and analysis similarities and differences between the two languages then give 3.2 DATA COLLECTION explanation to these 3.2.1 Sampling The samples for...
- 13
- 685
- 2
Tài liệu Marketing Food to Children and Adolescents - A Review of Industry Expenditures, Activities, and Self-Regulation docx
... characters only to fruit and vegetable companies as part of its Healthy Habits for Life program Disney characters appeared on packages and store displays for fruit snacks, breakfast cereals, candy, ... a great deal of information not previously collected and not otherwise available to the research community.3 Significantly, the Report gathers data from a year just before, or very early in the ... characters and marketed them in much the same way as other food and beverage companies: via company websites, in-store displays, and product packaging Third-party licensed characters and company proprietary...
- 120
- 451
- 0
A STUDY of PUEBLO ARCHITECTURE:Tusayan And Cibola docx
... kwakwanti made an expedition far to the north and came in conflict with a hostile people They fought day after day, for days and days they fought by day only and when night came they separated, ... to Oraibi The Squash people say that they came from Palát Kwabi, the Red Land in the far South, and this vague term expresses nearly all their knowledge of that traditional land They say they ... the Snakes, Horns, Bears, and Eagles each receiving separate lands, and these old allotments are still approximately maintained According to the Eagle traditions the early occupants of Tusayan...
- 479
- 372
- 0
Báo cáo khoa học: "A Comparison of Rule-Invocation Strategies in Context-Free Chart Parsing" pot
... Cocke KasamiYounger algorithm (Aho and Ullman 1972) A problem with this approach is that the analysis of the first part of a phrase has no influence on the analysis of the latter parts until the ... principle of bottom-up parsing is to reduce a sequence of phrases whose types match the righthand side of a grammar rule to a phrase of the type of the left-hand side of the rule To make a reduction ... more than a few lookups (depending on the degree of lexical ambiguity) Paradoxically, the effect of top-down filteringwas to degrade time performance as the grammars grew larger To a large extent...
- 8
- 355
- 0
Báo cáo khoa học: A study of microRNAs in silico and in vivo: diagnostic and therapeutic applications in cancer pot
... potential human oncogene Nature 435, 828–833 39 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y & Takahashi T (2005) A polycistronic microRNA cluster, ... frequently located at fragile sites and genomic regions involved in cancers Proc Natl Acad Sci USA 101, 2999–3004 36 Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, Harano T, Yatabe ... Tagawa H, Karnan S, Tsuzuki S, Karpas A, Kira S, Yoshida Y & Seto M (2004) Identification and characterization of a novel gene, C13orf25, as a target for 13q31-q32 amplification in malignant lymphoma...
- 8
- 432
- 0
Báo cáo khoa học: A study of microRNAs in silico and in vivo: bioimaging of microRNA biogenesis and regulation doc
... developmental stages and the changes of these networks in disease and after application of a variety of therapeutic strategies Critically, 2172 the noninvasive imaging approach of miRNA generation and ... other eukaryotic mRNAs, the primary transcript of miRNA is controlled by RNA polymerase II, and several transcription factors, including Oct4, c-Myc and Nanog, regulate the expression of primary ... implying the capability of the reporter gene system to assess and visualize the posttranscriptional regulation of miRNA [11] Therefore, a variety of imaging strategies, showing each step in the...
- 10
- 463
- 0
EV CITY CASEBOOK A LOOK AT THE GLOBAL ELECTRIC VEHICLE MOVEMENT doc
... KANAGAWA JAPAN KANAGAWA CREATES MEASURES TO PROMOTE EVs // BASIC POLICY Kanagawa Prefecture (K.P.G.) features many EVs, K.P.G launched EV Initiative Kanagawa and began automobile and battery production ... Trade and Industry) PHEVs are mainly used for rental cars and taxis for tourists and people can freely ride, and drive EVs and PHEVs on all of the islands Quick chargers and ITS spots are installed ... K.P.G and the town of Hakone aim to create an EV showcase and transform Hakone into a low carbon community As part of this plan, K.P.G., Hakone Town and private organizations are 3.7M ¥ LESS Nat’l...
- 75
- 398
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25