0

a plant protein storage vacuole sorting receptor

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Báo cáo khoa học

... PAGEseparation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose. (C) SDS ⁄ PAGE and silverstain of proteins isolated from AP sepharose (lane ... isothiocyanate; HB-19,5[Kw(CH2N)PR]-TASP; HSPG, heparin sulfate proteoglycan; PLAP, placental alkaline phosphatase; PTP, protein tyrosine phosphatase; RAP, receptor affinity probe; RPTP, receptor protein ... charged plates and incubated withvarious concentrations of FN3d–AP supernatant. Binding of FN3d–AP was determined by alkaline phosphatase (AP) activity measuredat 405 nm. The reaction rate...
  • 14
  • 669
  • 0
Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

Báo cáo khoa học

... activities. Eur.Cyt. Netw. 8, 359–365.36. Fukada, T., Hibi, M., Yamanaka, Y., Takahashi Tezuka, M.,Fujitani, Y., Yamaguchi, T., Nakajima, K. & Hirano, T. (1996)Two signals are necessary ... issubstantially independent of the JAK/STAT pathway.DISCUSSIONWe have successfully expressed an active fusion protein ofhuman CNTF and human soluble CNTF-R in mammaliancells. Hyper-CNTF has a calculated ... polyclonal rabbit anti-(phospho-STAT3) Ig and anti-(phospho-p44/42 MAP kinase) Ig. As secondary reagent,horseradish peroxidase (HRP)-conjugated goat anti-(rabbitIgG) Ig was used (Sigma, Deisenhofen,...
  • 9
  • 442
  • 0
Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc

Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc

Báo cáo khoa học

... aa208 aa24 aaBamH34 aaStartStopXho1N-Pro Protease domainProtease domainCT - ex380 aa1IINP114 aa208 aaBamH134 aaStartStopXho1SS SSGSSSSN-Pro356 aaIIIMSTLFIISILLFLASFSYAMDISTIEYKYDKSSAWRTDEEVKEIYELWLAKHDKVYSGLVEYEKRFEIFKDNLKFIDEHNSENHTYKMGLTPYTDLTNEEFQAIYLGTRSDTIHRLKRTINISERYAYEAGDNLPEQIDWRKKGAVTPVKNQGKCGSCWAFSTVSTVESINQIRTGNLISLSEQQLVDCNKKNHGCKGGAFVYAYQYIIDNGGIDTEANYPYKAVQGPCRAAKKVVRIDGYKGVPHCNENALKKAVASQPSVVAIDASSKQFQHYKSGIFSGPCGTKLNHGVVIVGYWKDYWIVRNSWGRYWGEQGYIRMKRVGGCGLCGIARLPYYPTKAAGDENSKLETPELLQWSEEAFPLAIV A B66 ... of a plant cysteine proteasemodulates proteolytic activity through a partial inhibitorymechanismSruti Dutta, Debi Choudhury, Jiban K. Dattagupta and Sampa BiswasCrystallography and Molecular ... protease from the latex of Ervatamia coronaria.Biosci Biotechnol Biochem 62, 1947–1955.15 GuhaThakurta P, Biswas S, Chakrabarti C, Sundd M,Jagannadham MV & Dattagupta JK (2004) Structuralbasis...
  • 13
  • 759
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Báo cáo khoa học

... sequencingand mutational analysis of a gene cluster involved innitrite reduction in Paracoccus denitrificans. AntonieLeeuwenhoek 66, 111–127.13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997)Gene ... FEBS23 Chang CK (1994) Heme d1and other heme cofactorsfrom bacteria. Ciba Found Symp 180, 228–238.24 Van Spanning RJ, Wancell CW, De Boer T, HazelaarMJ, Anazawa H, Harms N, Oltmann LF & ... in a mutant thatlacks NirF; this too is not trivial as the DnirF straindoes not accumulate readily detectable amounts of anintermediate of d1synthesis.Experimental proceduresDNA manipulationsDNA...
  • 12
  • 613
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

Báo cáo khoa học

... QuikChange site-directedmutagenesis kit (Stratagene, La Jolla, CA, USA). PlasmidpET-1TK was used as template and Kleb(HtoA)fw(5¢-GCTTAGCCGCGCCGGCATTCG) and Kleb(HtoA)rv(5¢-CGAATGCCGGCGCGGCTAAGC) ... phytate with pH optima in theacidic range. They consist of two domains, a large a ⁄ bdomain and a small a domain with the catalytic site atthe interface of the two domains [4,5]. HAPs can initi-ate ... todifferent habitats. To support plant growth, bacteriado not need to release phosphate as fast as the diges-tive tract of an animal host, where possible substratesmight be available for a limited...
  • 13
  • 766
  • 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Báo cáo khoa học

... (5¢-TACCGTTAACATCGATATGCATCATCATCATCATCATGC-3¢) was designed to insert a ClaI restric-tion site at nucleotide position )6, whereas the reverseprimer (5¢ -ATCGCCATGGTCCCGGGCATATGGGATCCCTGGAAGTACAGGTTTTCCTTTTTAATGGGTGTCCC-3¢) ... tothank Antonino Natalello and Silvia Maria Doglia fortheir assistance with the fluorescence spectroscopy, aswell as for critically reading the manuscript. We areindebted to Maria Samalikova ... (5¢-TACCTGGCCAATGAATATGCATCATCATCATCATCATACTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag and a ClaI restriction site at nucleotideposition –6 and a reverse primer (5 ¢ -A TCGCCATGGTCCCGGGCATATGGGATCCCTGGAAGTACAGGTTTTCGCCATGCTCTTGATCCC-3¢)...
  • 14
  • 672
  • 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

Báo cáo khoa học

... CGCTATTACCATGGTGATGC (nucleotides 4588–4608 of PCMV-Sport–b-gal plasmid)Sense ARS with PstI and SalI CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaGTCGACaatgcAntisense ... overallCMV β-gal β-gal β-gal β-gal (1) β-gal A C D B (2) ARS-β-gal CMV AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV (4) TOP-ARS-β-gal 5’-ccttctccccggcggttagtgctgagagtgc-3’ ... aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaS. Ma et al. PABP expression during heat shock recoveryFEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008...
  • 19
  • 596
  • 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

Báo cáo khoa học

... coloncarcinoma and rectal carcinoma as compared to normal colonic tissue. Colon carcinoma cells, rectal carcinoma cells and their normal healthytissue counterparts were harvested ( 1a, carcinoma ... C)Subcellular protein fractionation. Chemical fraction of cell pellets after FLAG–s-DAPK transfection into a cytosolic (A) and cytoskeletal (B)fractions for Flag–s-DAPK or Flag–s-DAPK-1Dtail (TD) as ... vitro at a faster rate than GST alone(Fig. 2E), supporting the existence of a protease thatcleaves s-DAPK-1 protein in vivo. The reason why thecleavage band was not observed in this assay may...
  • 11
  • 659
  • 0
Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

Báo cáo khoa học

... domain proteins; Y-box protein; polypyrimidine tract binding protein; mRNA stabilization;vascular endothelial growth factor.VEGF is an essential regulator of angiogenesis that acts onvascular ... as is observed for theIL-2 mRNA [31–33], and general mRNA stabilization[34–37]. PTB proteins may also play a role in generalmRNA stabilization [62].To investigate a role for the VEGF mRNA ... proteins have been shown to play a role in both induced [31–33] and general [34–37] mRNAstabilization. Recent data suggests that PTB proteins mayalso play a role in this latter type of mRNA...
  • 13
  • 604
  • 0
Tài liệu Báo cáo khoa học: Computational approaches to understand a-conotoxin interactions at neuronal nicotinic receptors doc

Tài liệu Báo cáo khoa học: Computational approaches to understand a-conotoxin interactions at neuronal nicotinic receptors doc

Báo cáo khoa học

... transmembrane domains, an intracellularloop and an extracellular C-terminus. a4 /b2 Receptors,which mainly control pain [7], and a7 receptors are themost abundant nAChR subtypes in the mammalian ... therapeutic application, whilstmaintaining their other remarkable features. We havegenerated homology models of several nAChR subtypes[2 7a] , so that we can start to analyse in detail the nAChRpharmacophore ... this information with the powerfulcomputational tools available today is facilitating drugdesign at the nAChRs.AcknowledgementsWe thank Joel Tyndall, Christina Schroeder and Ivana Saska for theircomments...
  • 8
  • 462
  • 0
Tài liệu Báo cáo khoa học: Structure-activity relationships of a-conotoxins targeting neuronal nicotinic acetylcholine receptors ppt

Tài liệu Báo cáo khoa học: Structure-activity relationships of a-conotoxins targeting neuronal nicotinic acetylcholine receptors ppt

Báo cáo khoa học

... Queensland, Brisbane, QLD, Australia a- Conotoxins that target the neuronal nicotinic acetylcho-line receptor have a range of potential therapeutic applica-tions and are valuable probes for examining ... a positive or negative way. Muta-tional analysis has indicated residues that are important forselectivity and potency, and structural analyses of suchmutants have suggested that what appear ... mutational analysis has been carried out onImI, PnIA, PnIB and to a lesser extent on GID and MII.Analysis of ImI has revealed that Asp5-Pro6-Arg7 andTrp10 are important for biological activity...
  • 7
  • 492
  • 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Báo cáo khoa học

... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-amplified ... Nomura ,A. ,Kawasaki,K.,Kubo,T.&Natori,S.(1992)Puri-fication and localization of p10, a novel protein that increases innymphal regenerating legs of Periplaneta americana (Americancockroach). ... observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding...
  • 11
  • 642
  • 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Báo cáo khoa học

... either at the Hospital for SickChildren (Toronto, Ontario, Canada) or t he NationalResearch Council Laboratory (Halifax, Nova Scotia,Canada). Sequence similarity amongst the p26 constructswas analyzed ... from Artemia cysts[57], and molecular mass markers o f 29 kDa (carbonicanhydrase), 66 k Da (bovine serum albumin), 150 kDa(alcohol dehydrogenase), 200 kDa (a- amylase), 443 kDa(apoferritin), and ... shock /a- crystallin protein from Artemia (Eur. J. Biochem. 269) 937Functional analysis of a small heat shock /a- crystallin protein fromArtemia franciscanaOligomerization and thermotoleranceJulie...
  • 10
  • 495
  • 0
Tài liệu Báo cáo Y học: A pool of Y2 neuropeptide Y receptors activated by modifiers of membrane sulfhydryl or cholesterol balance pot

Tài liệu Báo cáo Y học: A pool of Y2 neuropeptide Y receptors activated by modifiers of membrane sulfhydryl or cholesterol balance pot

Báo cáo khoa học

... little accumulationdue to receptor externalizationThe dynamics of appearance of additional surface sites at30 lMPAO indicated a fast activation, as the increase in thelabeling by agonist ... at 4000 g to separate the extracted(originally cell-surface attached) and the residual (internal-ized) radioactive peptide. Receptor characterizationThe homogenization or NPY receptor assay ... monolayers or particulates, andto dispersed rat forebrain cells. The labeled Y2 agonist was input at50 pMin all cases. For assay details see Methods. All data, shown± SEM, are averages of...
  • 8
  • 469
  • 1
Báo cáo khoa học: Serine-arginine protein kinases: a small protein kinase family with a large cellular presence potx

Báo cáo khoa học: Serine-arginine protein kinases: a small protein kinase family with a large cellular presence potx

Báo cáo khoa học

... (Sky1and Dsk1, respectively); Candida albicans with two(QSAA48 and QS9Q27); Aspergilus niger with nine (A2 QAE4, A2 QB94, A2 QC46, A5 AB23, A2 QWQ2, A2 QX01, A2 QX98, A2 R2M0 and A2 RSV1)]; plantswith ... and 1a is nega-tively affected by interaction with scaffold attachmentfactors B1 and 2. FEBS J 276, 5212–5227.18 Nakagawa O, Arnold M, Nakagawa M, Hamada H,Shelton JM, Kusano H, Harris TM, Childs ... (2006)Targeting the RNA splicing machinery as a novel treat-ment strategy for pancreatic carcinoma. Cancer Res 66,3819–3827.57 Hishizawa M, Imada K, Sakai T, Ueda M, Hori T &Uchiyama T (2005)...
  • 17
  • 375
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008