0

a novel theory in heat transfer analysis and optimization

mass and heat transfer analysis of mass contactors and heat exchangers (cambridge series in chemical engineering)

mass and heat transfer analysis of mass contactors and heat exchangers (cambridge series in chemical engineering)

Hóa học - Dầu khí

... basic physical principles underlying mass and heat transfer and be able to apply those principles to analyze existing equipment and design and analyze laboratory experiments to obtain data and ... combined presentation of heat and mass transfer, maintaining mathematical rigor while keeping mathematical analysis to a minimum This allows students to develop a strong conceptual understanding ... approach to heat and mass transfer Models of the physical situations encountered in heat and mass transfer are almost always a set of algebraic or differential equations A straightforward application...
  • 405
  • 3,221
  • 0
báo cáo khoa học:

báo cáo khoa học: "Gene-expression and network-based analysis reveals a novel role for hsa-mir-9 and drug control over the p38 network in Glioblastoma Multiforme progression" ppsx

Báo cáo khoa học

... name Target Pathway Accutane RARA Map kinase inactivation of smrt co-repressor CCNU STMN4 Signaling mediated by p38-gamma and p38-delta pathway Celebrex COX2 Signaling mediated by p38-alpha and ... network interactions dataset: Network information was obtained from the National Cancer Institute's Pathway Interaction Database [12] Gene-expression analysis Pathway Consistency and Pathway Activity ... p38-beta pathway Cis Retinoic Acid RARA Map kinase inactivation of smrt co-repressor Sorafenib RAF1 p38 signaling mediated by MAPKAP kinases Tamoxifen ESR1 Signaling mediated by p38-alpha and p38-beta...
  • 26
  • 278
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article LCMV Beamforming for a Novel Wireless Local Positioning System: Nonstationarity and Cyclostationarity Analysis" doc

Báo cáo khoa học

... data j j length for Rq estimation If yq [n] is a stationary and ergodic process, the sample average equals time average, and the sample covariance matrix estimator leads to an accurate estimate ... studied separately for more than fifty years In recent decades, a joint consideration of beamforming and cyclostationarity (i.e., beamforming for cyclostationary signals) attracted certain attention ... EURASIP Journal on Advances in Signal Processing are adopted in the WLPS The conventional beamforming methods (delay and sum) in the WLPS have been discussed in [7] In general, linear constrained...
  • 12
  • 308
  • 0
báo cáo khoa học:

báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx

Báo cáo khoa học

... prolactine producing pituitary adenoma, the hyperplasia of the parathyroid glands and the well-differentiated non functioning pancreatic endocrine carcinoma, functioning bilateral adrenocortical ... Novotny EA, Garrett-Beal L, Ward JM, Libutti SK, Richard Alexander H, Cerrato A, Parisi MJ, Santa Anna-AS, Oliver B, Chandrasekharappa SC, Collins FS, Spiegel AM, Marx SJ: Molecular pathology ... 89:143-150 11 Carrasco CA, González AA, Carvajal CA, Campusano C, Oestreicher E, Arteaga E, Wohllk N, Fardella CE: Novel intronic mutation of MEN1 gene causing familial isolated primary hyperparathyroidism...
  • 7
  • 412
  • 0
Báo cáo y học:

Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx

Báo cáo khoa học

... protein Sip1 Sip1 is a nuclear splicing factor containing an arginine/serine-rich domain and a RNAbinding motif that may play a role in linking the processes of transcription and pre-mRNA splicing ... human antibodies (0.1 µg/µl) in PBS containing 1% bovine serum albumin Fluorescein isothiocyanate-conjugated anti-human IgG (Sigma) was added and fluorescence was analysed with an Available online ... participated in the analysis and interpretation of data and helped to draft the manuscript RR participated in the design of the study and in the revision of the manuscript EP participated in analysis...
  • 8
  • 550
  • 0
báo cáo khoa học:

báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx

Báo cáo khoa học

... GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA ... CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC ... shikimate/quinate hydroxycinnamoyltransferase from Arabidopsis thaliana (ABH04595); Nt_HCT, shikimate/quinate hydroxycinnamoyltransferase from Nicotiana tabacum (CAD47830); Nt_HQT, hydroxycinnamoyl...
  • 13
  • 650
  • 0
Performance analysis of an endoreversible rectangular cycle with heat transfer loss and variable specific heats of working fluid

Performance analysis of an endoreversible rectangular cycle with heat transfer loss and variable specific heats of working fluid

Môi trường

... combustion and heat transfer α is a parameter related to the combustion and it reflects the heating value of the fuel β is a parameter related to heat transfer loss In this case, when α increases about ... endoreversible rectangular cycle with heat transfer loss and variable specific heats of working fluid Cycle model An air standard rectangular cycle is shown in Figure The heat additions are an isochoric ... The influence of k on cycle work output versus efficiency Conclusion In this paper, an air-standard rectangular cycle with heat transfer loss and variable specific heats of working fluid is analyzed...
  • 8
  • 336
  • 0
A novel sec7 domain containing protein BIG3 and its role in regulated secretory pathway

A novel sec7 domain containing protein BIG3 and its role in regulated secretory pathway

Cao đẳng - Đại học

... Abbreviations aa amino acid ACTH adrenocorticotropic hormone AMPK AMP-activated Protein Kinase AOX coenzyme A oxidase AP-1 adaptor protein-1 ARF ADP ribosylation factor Arg arginine ARNO ARF nucleotide ... primer pair: 5’-GAG AAG AAG GAT CCC AGC CGG AAG AAG-3’ and 5’-CGC GTC GAC CAC AAT GAT GTC ATA GAC-3’ and digested with BamHI-SalI and ligated to C-terminal of EcoRI-BamHI fragment in pUC19 The full ... al., 1991) and plays a key role in ER–Golgi and intra-Golgi transport (Franzusoff et al., 1992) Mammalian BIG1 and BIG2 are mainly localized to the trans face of Golgi apararus They catalyze nucleotide...
  • 189
  • 302
  • 0
An efficient and robust algorithm for incompressible flow and its application in heat transfer enhancement

An efficient and robust algorithm for incompressible flow and its application in heat transfer enhancement

Cao đẳng - Đại học

... wet and frosted surfaces in heat exchangers with simultaneous heat and mass transfer 1.2.2.2 Wavy fin -and- tube heat exchanger Jang and Chen (1997) numerically simulated the heat transfer and ... drop in the plain fin -and- tube heat exchanger, they found that heat transfer can be increased by placing the fin tube at downstream region, and increasing ellipticity of the fin tube can lead to ... three-dimensional incompressible flow and heat transfer in plain fin -and- tube heat exchangers, the tube arrangement, tube row numbers and fin pitch were investigated in details They found that the average heat...
  • 251
  • 366
  • 0
BEMFVM conjugate heat transfer analysis of a threedimensional film cooled turbine blade

BEMFVM conjugate heat transfer analysis of a threedimensional film cooled turbine blade

Toán học

... Rahaim, C., Cavalleri, R.J and Kassab, A. J (1997), “Computational code for conjugate heat transfer problems an experimental validation effort”, AIAA Paper 97-2487 Rahaim, C.P., Kassab, A. J and ... and temperatures, in the case of CHT analysis, or displacement and traction, in the case of aero-elasticity analysis A different approach was taken by Li and Kassab (199 4a, b) and Ye et al (1998), ... transfer in turbine blades with internal cooling”, AIAA/ASME Paper 94-2933 Li, H and Kassab, A. J (1994b), A coupled FVM/BEM solution to conjugate heat transfer in turbine blades”, AIAA Paper 94-1981...
  • 30
  • 395
  • 0
Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

Báo cáo khoa học

... trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP ... observed with the single-cysteine-containing isoforms Obtaining full labelling and its accurate quantitation are difficult to achieve in practice, resulting in occasional instances where values for the ... Crowley et al reflect localization at the membrane–solute interface There was no alteration in the extent of labelling by BM in any conformational state examined In contrast, there was a dramatic reduction...
  • 12
  • 380
  • 0
Báo cáo khoa học: Enhanced peptide secretion by gene disruption of CYM1, a novel protease in Saccharomyces cerevisiae doc

Báo cáo khoa học: Enhanced peptide secretion by gene disruption of CYM1, a novel protease in Saccharomyces cerevisiae doc

Báo cáo khoa học

... LJY430 LJY431 LJY432 MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa Euroscarf [16] ATCC [15] This study ... peroxidase and a dinamin-like GTPase, and is required for maintenance of mitochondrial morphology and DNA [45,46] Whether disruption of CYM1 in uences the ability to maintain mitochondrial DNA has ... intracellular amount of CCK and the CCK(K6 1A) mutant in the vacuole protease deficient strain, BJ2168 and the cym1D0 strain were analysed using Ab 7270 before and after trypsin/carboxypeptidase B treatment...
  • 10
  • 631
  • 0
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf

Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf

Báo cáo khoa học

... The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB for ... the PA–substrate interactions in the transition state are missing and only a GRID computational modelling approach to the tetrahedral intermediate in PA presents some indications of the importance ... the initial rates for at least seven different substrate concentrations using the nonlinear regression data analysis software ENZFITTER [31] Modelling and analysis of interaction energies within...
  • 8
  • 438
  • 0
Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Báo cáo khoa học

... Polyamine aggregates and DNA L D’Agostino et al Fig Interaction of single nuclear aggregates of polyamines (NAPs) with different DNA forms (A) Small-size NAP (s-NAP) interacting with A- DNA Grey ... Saminathan M, Thomas T, Shirahata A, Pillai KS & Thomas TJ (2002) Polyamine structural effects on the induction and stabilization of liquid crystalline DNA, potential applications to DNA packaging, ... the charge attraction between DNA phosphates and the amino groups of polyamines As the amino groups of polyamines are already engaged in ionic bonds with the phosphates of NAPs, secondary amino...
  • 11
  • 380
  • 0
Heat Transfer: Basics and Practice ppt

Heat Transfer: Basics and Practice ppt

Kiến trúc - Xây dựng

... gives an overview of heat transfer applications Table 1.1: Area of heat transfer applications Heating, ventilating and air conditioning systems Thermal power plants Refrigerators and heat pumps Gas ... the heat transfer coefficient α, the heat transfer surface area A and the temperature difference Δϑ The heat transfer coefficient defines the heat rate Q transferred per unit transfer area A and ... Celsius and T for the absolute temperature 1.2.1 Heat (transfer) rate and heat flux The heat rate, also called heat transfer rate Q is the amount of heat transferred per unit time It has the unit Watt...
  • 291
  • 459
  • 1
Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx

Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx

Báo cáo khoa học

... and the area dorsal to the substantia nigra in the midbrain reticular formation By immunostaining using monoclonal antibody against the N-terminus of the human relaxin-3 A- chain [2], relaxin-3-immunoreactive ... metabolism Actions of relaxin-3 at the hypothalamo-pituitarygonadal (HPG) axis Fig Effect of intracerebroventricular administration of relaxin-3 in satiated male Wistar rats (A) Effect of human relaxin-3 ... regulation of the HPG axis was reported in that intracerebroventricular (5 nmol) and intra-PVN (540–1620 pmol) administration of relaxin-3 in adult male rats significantly increased plasma luteinizing...
  • 8
  • 369
  • 0
Báo cáo khoa học: Light regulation of CaS, a novel phosphoprotein in the thylakoid membrane of Arabidopsis thaliana doc

Báo cáo khoa học: Light regulation of CaS, a novel phosphoprotein in the thylakoid membrane of Arabidopsis thaliana doc

Báo cáo khoa học

... for CaS were 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and 5¢-CAGTCGGAGCTAGGAAGGAA-3¢ Isolation of plasma membrane, intact chloroplasts, stroma and thylakoids The plasma membrane fraction of Arabidopsis was ... (AY341888) was amplified by PCR using PfuTurbo CX Hotstart DNA polymerase (Strategene, La Jolla, CA, USA) and the uracil-containing primers nt114 (forward: GGCTTAAUATGGCTATGGCGGAAATGG CAACGA) and ... to be involved in signal transduction and stress responses and also in protein import into chloroplasts [32] FHA domain proteins are directly involved in signal transduction, and the interaction...
  • 11
  • 446
  • 0
convective heat transfer mathematical and computational modelling of viscous fluids and porous media

convective heat transfer mathematical and computational modelling of viscous fluids and porous media

Hóa học - Dầu khí

... mechanism and in such cases the heat transfer surface area may be increased for the augmentation of heat transfer rates It also arises in the design of thermal insulation, material processing ... Kulkarni et al (1987) and Angirasa and Srinivasan (1992) have studied the similarity solutions of the laminar free convection boundary-layer equations for a fixed wall temperature and a linear, ... and Watanabe (1992), Chaudhary and Merkin (1993) and Merkin (199 4a) The last two papers consider the cases when the wall temperature, wall heat flux and transpiration velocity are proportional...
  • 648
  • 796
  • 0
process heat transfer principles and applications

process heat transfer principles and applications

Hóa học - Dầu khí

... British Librar y Cataloguing in Publication Data Serth, R W Process heat transfer : principles and applications Heat - Transmission Heat exchangers Heat exchangers - Design Heat - Transmission ... sophisticated methods for performing shell-side heat- transfer and pressure-drop calculations are presented separately in Chapter (full Delaware method) and Chapter (Stream Analysis method) Heat exchanger ... corner of wall (Table 1.3) Total amount of heat transferred Rate of heat transfer Rate of heat transfer in x-, y-, or r-direction Heat flux Rate of heat generation per unit volume → → → Heat flow vector...
  • 770
  • 464
  • 0
a first corse in finite element analysis

a first corse in finite element analysis

Cơ khí - Chế tạo máy

... book In stress analysis, for most analyses of operational loads, linear analysis is adequate as it is usually undesirable to have operational loads that can lead to nonlinear material behavior ... aircraft; b seismic analysis of dams, power plants, cities and high-rise buildings; c crash analysis of cars, trains and aircraft; d fluid flow analysis of coolant ponds, pollutants and contaminants, ... Model Modifying the Material Definition Configuring the Analysis Applying a Boundary Condition and a Load to the Model Meshing the Model Creating and Submitting an Analysis Job Viewing the Analysis...
  • 344
  • 3,220
  • 0

Xem thêm