0

a metabolic pathway is a chain of chemical reactions

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Báo cáo khoa học

... only as a carbon source, but also as a nitrogensource for g rowth of the assimilating bacteria. Deaminases,which catalyze the release of ammonia, are a key enzyme inthe metabolic pathways of ... tosequences of 2-aminomuconate deaminases [6,8,27] or toany other sequences available in FASTA and BLASTdatabase programs at the DNA Data Bank of Jap an.Recently, we reported the cloning and s equencing ... NADPH, and glutamate dehydrogenasewere from Wako Pure Chemicals (Osaka, Japan); meatextract (Extract Ehlrich) w as from Kyokuto Seiyaku Kogyo(Osaka, Japan); and pentafluorophenylhydrazine was...
  • 7
  • 613
  • 1
Báo cáo y học:

Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

Y học thưởng thức

... significant at a 10% level in the univariate analysis andsubjected to multivariate Cox regression analysis: lactate,APACHE II score, SOFA score and circulating Ang-2 (Table2). Except for Ang-2 ... optimal cut-off values. Data are displayed asmedian and range (minimum to maximum) unless otherwisestated. All statistical analyses were performed with the SPSSTable 1Demographic, clinical and ... Systems,Minneapolis, USA). This assay measures biologically activeVEGF121 and VEGF165.Statistical analysisDifferences between patients and healthy controls were eval-uated using a non-parametric...
  • 9
  • 634
  • 0
Báo cáo y học:

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Y học thưởng thức

... 51:189-197.27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali-dation of a behavioral pain scale in critically ill, sedated, andmechanically ventilated patients. Anesth Analg 2005,101:1470-1476.28. ... acquisition of data. NMhelped to draft the manuscript, and participated in the acquisi-tion of data. AZ participated in the coordination of the study.AAZ participated in the design of the study, and ... the analyzer Cobas Integra (RocheDiagnostics, Mannheim, Germany). The limits of detectionwere 0.071 mg/dl.Statistical analysesData are presented as the mean ± standard deviation for vari-ables...
  • 10
  • 597
  • 0
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Tài liệu khác

... than, a decade ago. (A) equally as prevalent, if not more so than, a decade ago.(B) equally as prevalent, if not more so than, it was a decade ago.(C) as prevalent, if not more than a decade ... duplicate com-pared to the cost of developing and marketing the software. Theactual cost of duplicating a software program, which may have a retail value of $400 or more, can be as little as a ... as any candidate in the state’shistory.(B) she had been reelected with as wide of a margin as any candidate in thestate’s history.(C) having been reelected with as wide a margin as any candidate...
  • 696
  • 1,001
  • 1
Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx

Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx

Chụp ảnh - Quay phim

... situations. To mask some of the noise at low light levels, consumer cameras often use a setup, or black level, of zero IRE, rather than the 7.5 IRE broadcast standard. Some cameras that automatically ... see cameras advertised as 2 LUX or 4 LUX cameras. 2 LUX is equal to .19 foot candles. 4 LUX is about .37 foot candles. I was suspicious, so a number of years ago I set up an ordinary candle ... foot away from a white square on a black background. I tested two cameras. The first was a popular CCD camera requiring four LUX for minimum illumination. The second was a broadcast camera using...
  • 6
  • 462
  • 1
Learning english is a piece of cake 1

Learning english is a piece of cake 1

Kỹ năng nói tiếng Anh

... raɪz njuː wɜːdz and grammatical rules. In fact, learning English can be a piece of cake. ənd ɡrə ˈmæt ɪk əl ruːlz ɪn fækt ˈlɝːn ɪŋ ˈɪŋ ɡlɪʃ kæn biː ə piːs ʌv keɪk Don’t worry about ... worry about pronunciation. Don’t worry about grammar. doʊnt ˈwɝːɪ ə ˈbaʊt prə ˌnʌnts i ˈeɪʃ ən. doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes. Just try to speak. doʊnt biː ə ... http://langmaster.edu.vn | Crazy English Trainers: WaNo: 01653.994.122 | Chuẩntt : 0985.82.87.87 In fact, she is a sales person! 7. “Improve” = cải thiện, cải tiến. I want to improve...
  • 2
  • 1,669
  • 15
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Báo cáo khoa học

... 5-GACGAGATTATCAGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAGAGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATGAGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3.AcknowledgementThis project was supported by grants from the Aus-trian Science ... ACTIN2gene as an internal standard. PCRs were performed usingthe following primers: ACT2 (At3g18780): 5-ACATTGTGCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAGAATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATCAGATTTTACGC-3 ... Yasuda T (2002) Activation of AtMEK1, an Ara-bidopsis mitogen-activated protein kinase kinase, in vitroand in vivo: analysis of active mutants expressed in E.coli and generation of the active...
  • 11
  • 700
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Báo cáo khoa học

... in a mutant thatlacks NirF; this too is not trivial as the DnirF straindoes not accumulate readily detectable amounts of anintermediate of d1synthesis.Experimental proceduresDNA manipulationsDNA ... 252.221.81.41.21.610.80.60.40.20 A 600 A 600 A 600Time (h)Fig. 5. His41 is essential for Paracoc-cus pantotrophus NirF, but Asp129 is dis-pensable. Growth plots and time courses of nitrite appearance and disappearance ... d1heme lacking iron and ⁄ or with the side chain satu-rated, but accessing these putative substrates is nottrivial. An alternative approach would be to seek accu-mulation of the substrate of NirF...
  • 12
  • 613
  • 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

Báo cáo khoa học

... CGCTATTACCATGGTGATGC (nucleotides 4588–4608 of PCMV-Sport–b-gal plasmid)Sense ARS with PstI and SalI CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaGTCGACaatgcAntisense ... overallCMV β-gal β-gal β-gal β-gal (1) β-gal A C D B (2) ARS-β-gal CMV AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV (4) TOP-ARS-β-gal 5’-ccttctccccggcggttagtgctgagagtgc-3’ ... aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaS. Ma et al. PABP expression during heat shock recoveryFEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008...
  • 19
  • 596
  • 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Báo cáo khoa học

... AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACAATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTGpGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGAATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACCATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAGpYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2...
  • 14
  • 517
  • 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Báo cáo khoa học

... 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAGReverse ompA105 5¢-GCCATGAATATCTCCAACGAGReverse ompA117 5¢-CATCCAAAATACGCCATGAATATCForward 5¢rpsO 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCGReverse 5¢rpsO 5¢-GCTTCAGTACTTAGAGACForward ... 5¢-GCTTCAGTACTTAGAGACForward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACCReverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGGForward rpsO internal 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTGReverse ... 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTGReverse 3¢rpsO-(C)18 5¢-C(18)GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(G)18 5¢-G(18)GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(N)18 5¢-GAATTGCTGCCGTCAGCTTGAForward oxyS109* 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTTReverse...
  • 10
  • 488
  • 0
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf

Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf

Báo cáo khoa học

... ClonepRKX3, a derivative of tRNAGly1-1 has a single TATA ele-ment at )130 bp and is transcribed to the same levels as theparent. pmutRKX3 has the single TATATAA element of pRKX3 mutated to GATATCA. ... EF & Maniatis T (1989) MolecularCloning: A Laboratory Manual, 2nd edn. Cold SpringHarbor Laboratory Press, Cold Spring Harbour, NY. A. Parthasarthy and K. P. Gopinathan Regulation of pol ... containing TATATAA sequences. Transcription of tRNAGly1-1 was carried out in the presence of increasing concentrations of a 40 bp fragment containing the TATATAA sequence upstream of the coding...
  • 15
  • 484
  • 0

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25