... presence of an excess of nonspeci c competitor calf thymus DNA mimicking randomsequence natural genetic material that can accommodate the cisplatin adducts regardless of the reactivity 4700 Fig Competition ... DNA comprises about 50% of 1,2-GG IACs, 25% of 1,2-AG IACs, 10% of 1,3-GNG IACs and interstrand crosslinks, and another 2–3% of monofunctional adducts It has been found that cisplatin cytotoxicity ... forms [33] Recently, it has been reported that accessibility of the p53 CTDBS is critical for (sequence-nonspeci c) cisPtDNA recognition [34] On the other hand, sequencespeci c binding of p53 to...
... forward and reverse primers, ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) ... also cloned the cDNA encoding rabbit fast skeletal TnI from the back muscle of rabbit by RT-PCR using the primer set, RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) ... (5¢-GAGCATGGCGGGAT CCTACATGCGCAC-3¢) and RTnI96F (5¢-GCTGGAGG CCATGGACCAGAAGC-3¢) and RTnI181R, respectively (BamHI ⁄ NcoI sites and termination ⁄ initiation codons are indicated by underlines and bold...
... 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary primers 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢ All primers were purchased ... complementary primers 5¢-GGATGAGGCTACCAGTGC TC TGGACGCCTAG TGCGAGCAGGC-3¢ and 5¢-GCCTGCTCGCACTAGG CGTCCAGAGCACTGGTAGCCTCATCC-3¢ All TAP constructs were transfected into T2 cells by electroporation using a ... 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ for 2V1 The resulting TAP constructs were cloned into the EcoRI site of pHbApr1neo [22] and sequenced fully...
... different and balancingfeatures Gawaine is outgoing and quick to act, but he is balanced by Gaheris who isreclusive and slow to action Agravaine is sadistic and selfish, but he is balanced by Garethwho ... sadistic and selfish, but he is balanced by Garethwho is kind and generous They compliment each other and together are stronger thanthey can ever be apart ...
... haemolytic Actinobacillus equuli in the oral cavity of horses Comparative investigations of strains obtained and porcine strains of A suis sensu stricto Acta Pathol Microbiol Immunol Scand B 1984, ... plates were incubated at 37 C for up to 24 h After incubation, colonies matching the description of Actinobacillus spp were selected and subcultured twice on blood agar After subculture, isolates ... speci c antibodies against actinobacilli present in the oral cavity of healthy mares could be detected in their serum and colostrum and if such antibodies could also be found in the serum of...
... activation of a family of cytosolic cysteine proteases, caspases, which are required for many of the morphological changes that occur during apoptosis The mitochondrial release of cytochrome c ... membranes, which liberates cytochrome cand activates caspase and the apoptosome [23] Transfection of tBid directly triggers mitochondrial-dependent apoptosis and caspase activation [17] Because Itch overexpression ... final concentration of 1% Extracts were incubated for 20 at Cand centrifuged at 18 000 g in a microcentrifuge at C For immunoprecipitation assays, extracts of transfected cells were immunprecipitated...
... region of the SiVgR gene (amino acid 648–878) using primer set VgRi-f1 (5¢-TAATACGACTCACTATA GGGGCCATCTGCAATTATCAACGCCTTTCTTAACG TC-3¢) and VgRi-r1 (5¢-TAATACGACTCACTATAGGG ACCACATACTGTGCATCGCGTGAATAAGGTGTC-3¢), ... sequence) [36] was amplified as template with primer set VgRi-f4 (5¢-TAATACGACT CACTATAGGGCGTGATCAGGTCAAAACGTATTTTC TTCATTT-3¢) and VgRi-r3 (5¢-TAATACGACTCACTATA GGGGCCACAGTCATCCTTTTTATCGCATACTAC-3¢) ... SiVgR-2.3-3-2, 5¢-ACAAGAGCCATTCTCTATGACGGTCTTTC-3¢, and SiVgR-2.3-4r, 5¢-CTGACCTGAGAGCGGATCAGATAT TATATTCAC-3¢, and the conditions were 94 C for min; 28 cycles of 94 C for 30 s, 60 C for and 72 C for...
... regulating the manufacture, marketing and distribution of tobacco products, protecting public health and reducing tobacco use by minors Accordingly, the Center for Tobacco Products was established ... 2010, CDC is building a cadre of health protection researchers, research training programs, and centers of excellence that enable multidisciplinary approaches to public health practice Performance ... patients, clinicians, and other decision-makers about what interventions are most effective for patients under specific circumstances TRANSPARENCY AND ACCOUNTABILITY Transparency: HHS Recovery Act funds...
... ADPinduced platelet aggregation Proc Natl Acad Sci USA 95, 8070–8074 ´ Gachet C, Hechler B, Leon C, Vial C, Leray C, Ohlmann P & Cazenave JP (1997) Activation of ADP receptors and platelet function ... thrombin-induced Ca2+ integral with an IC50 of approximately 10 nm and lm, respectively, which is in accordance with the known affinity of these compounds for the PI3-K catalytic subunits At these concentrations ... thrombin is induced in situ by activation of PRP with tissue factor and CaCl2, the P2Y12 ⁄ PI3-K pathway significantly enhances the activation state and, hence, the procoagulant activity of platelets...
... were analyzed The percentages of the PrPC bands were calculated as arithmetic means and SE according to the antibody used for PrP detection Calculation of the banding patterns of 16 gels using antibody ... PrPC derived from cortex (c) , cerebellum (cb) and brain stem (bs) of sheep detected by antibodies SAF34 and SAF70, respectively (B) PrPC signals of cortex (c) , cerebellum (cb) and brain stem (bs) ... given for each antibody, and, accounting for differences among gel runs, SE values were calculated according to antibody used for PrP detection Calculation of the banding patterns of 17 gels using...
... nuclear genome coded isoforms of CytOX V [10,32] The regulation of genes CytOX5a and CytOX5b, coding for the two isofoms Va and Vb, parallels that of genes CYC1 and CYC7, which encode iso-1 and ... iso-2 of yeast cytochrome c, respectively CytOX 5a and CYC1 are coexpressed under aerobic conditions (O2 > 0.5 lM), whereas CytOX 5b and CYC7 are co-expressed under hypoxic (O2 < 0.5 lM) and heme ... the catalytic activity of the enzyme by affecting its stability or composition Although succinylacetone and CoCl2 are known inhibitors of heme biosynthesis, these agents also elicit nonspeci c and...
... NapC_Rsph CymA_Sput NrfH_Ddes NrfH_Sdel NrfH_Wsuc Cytc_Dgig Cytc_Ddes 110 L ECRNCHNF E L ECRNCHSAE L ECRNCHAAV L ECRNCHSEV ANCQHCHT RI ANCKACHT QT CI S CHQS L CI SCHASL CHNI L CHANT ... sequencing, the oligonucleotide ccNiR_GTPRNGPW, 5¢-GGIACICCIMGIAAYG GICCITGG-3¢, was synthesized and used together with the primer ccNiR_Cterm, 5¢-TCYTGICCYTCCCASACYT GYTC-3¢, already used in nrfA ... Structural and functional approach toward a classification of the complex cytochrome c system found in sulfate-reducing bacteria Biochim Biophys Acta 1058, 61–66 Ó FEBS 2003 Characterization of ccNiR...
... chain factors, eukaryotic class polypeptide chain release factor (eRF1) and eukaryotic class polypeptide chain release factor (eRF3) The major functions of eRF1 include recognition of each of the ... structure and function of the eRF1 C- domain A B C E D Fig The solution structure of the C- domain (A) Stereo view of the ensemble of the final 48 calculated structures Twenty-four structures of ... were incubated at 37 C with 2.5 pmol of eRF1 for 0–15 Ribosomes and tRNA were pelleted with ice-cold 5% trichloroacetic acid, supplemented with 0.75% casamino acids, and centrifuged at Cand 14...
... 5¢-TTCGA GGCCCGCGCCGCAATTGGGGGCCCAGAA-3¢ and 5¢TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E190A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGC CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E190A, 5¢-CAAATTGGGGG ... CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E199A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC AAG-3¢ and 5¢-CTTGGCTCCAGACTGTGCAGACTTCC CAGCTTC-3¢ for E204A Mutated codons ... during chaperone action Indeed, the presence of significant regions of structural disorder is a common characteristic of molecular chaperones, and is integral to their effective chaperone action...
... the transactivation of growth hormone receptors and in the activation of MAPK cascades, as well as different localizations of the receptor constructs before and after activation may also contribute ... Faussner et al Role of helix and C- termini in bradykinin receptors Fig Schematic representation of the C- terminal B1wt and B2wt sequences and chimera thereof The C- terminal sequences beginning at ... intact cells Biol Chem 385, 835–843 21 Marchese A, Chen C, Kim YM & Benovic JL (2003) The ins and outs of G protein-coupled receptor trafficking Trends Biochem Sci 28, 369–376 22 Kalatskaya I, Schussler...
... (shuffled[]) and place random numbers from to 52 in it Once we have the random numbers, we just display the card names in that order string cards[52]={ "CA", "C2 ", "C3 ", "C4 ", "C5 ", "C6 ", "C7 ", "C8 ", "C9 ", "C1 0","CJ","CQ","CK", ... data, the second one to find the difference of each score from the mean and the third one to find store the square of deviation of each score The mean is calculated by adding all valid scores stored ... Read scores from a file into an array Keep track of number of scores entered Find difference of each score from the Mean Square the differences and add the squares find stadard deviation create...
... 2.9 Safety and Courtesy Concerns This critique makes two general types of criticism about ‘safety’ concerns and ‘courtesy’ concerns These themes recur throughout this critique, as Cand C+ + have ... bounds; and a class of type checks that are discussed in the section on RTTI and type casts The current ideal is to have the detectable and real inconsistency domains exactly coincide, with as few checks ... failures Courtesy concerns affect the internal view of the quality of a program in the development and maintenance process Courtesy concerns are usually stylistic and syntactic, whereas safety concerns...
... MALDI-TOF-TOF mass spectrometry A selection of mass spectra illustrates how the comparison of chymotryptic peptides from different cross-linked complexes and protein controls allows the detection of ... binding of Ssa1p in the vicinity of this stretch interferes with Ure2p assembly into fibrils either because of a change in the conformation of this stretch or the crowding of a surface interface involved ... Ure2p–Ssa1p complexes with apparent molecular masses of 120 and 160 kDa were excised Each protein band was subjected to in-gel enzymatic cleavage after reduction and alkylation of cysteine residues...
... pmol of HPLC-purified primer WT (5¢-AATTGATCCCGCCCG CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA ACATGGCGCCGCTGCGGGGC-3¢) using 50 lCi of [c- 32P]ATP (3000 CiÆmmol)1; GE Healthcare) and 100 units of T4 ... The oligonucleotide WT was used as a template for amplification of a 70 bp PCR product with [5¢-32P]-labeled S70ds ⁄ UP (5¢-AATTGATCCCGCCCGCCTC-3¢) and S70ds ⁄ DN (5¢-GCCCCG CAGCGGCGCCATGTT-3¢) ... acids are colored according to properties: basic, blue (K, R and H); acidic, red (D and E); hydrophobic, green (P, L, I, V, M, F, W, Y and A); polar, purple (N, Q, S and T); and black (G and C) ...