0
  1. Trang chủ >
  2. Thể loại khác >
  3. Tài liệu khác >

17 4 K Ngoai TK Multiple bur hole surgery for the treatment of Moyamoya Disease

 Báo cáo y học:

Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

... Coronary angiography remains the gold standard for the morphologic diagnosis of CAD and also allows revascularization during the same procedure [12, 13] Coronary angiography is a relatively safe and ... Combined Analysis Total USA Asia Germany female male < 65 years 65+ years Female, < 65 years Female, 65+ years Male, < 65 years Male, 65+ years No Revasc PCI CABG Revasc of any type ROC AUC Odds Ratio ... in this meta -analysis was not to study MCG as a screening device, but instead to focus primarily on its potential as a diagnostic assay for relevant coronary stenosis Resting ECG analysis, including...
  • 13
  • 684
  • 0
Tài liệu Multiple Vulnerabilities qualitave data for the stydy of orpharns and vulnerable children in South Africa ppt

Tài liệu Multiple Vulnerabilities qualitave data for the stydy of orpharns and vulnerable children in South Africa ppt

... countries in southern Africa, these being South Africa, Botswana and Zimbabwe The project aims to contribute towards improvement of the conditions of OVC in these countries In South Africa, the HSRC ... taking in children for the purposes to take advantage of their grants A number were accused of taking the grants for themselves and providing minimal care and assistance to the children that they ... developed and the gold reserves in the mines are running out The collapse of the mining industry raises further problems, for example, most of the migrant labourers left the community when they lost their...
  • 118
  • 628
  • 0
The Eugenic Marriage, Vol 2 (of 4), by W. Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Pro pptx

The Eugenic Marriage, Vol 2 (of 4), by W. Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Pro pptx

... The Project Gutenberg EBook of The Eugenic Marriage, Vol (of 4), by W Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever You may copy ... You may copy it, give it away or re -use it under the terms of the Project Gutenberg License included with this eBook or online at www.gutenberg.org Title: The Eugenic Marriage, Vol (of 4) A Personal ... mankind It is useless to think that these diseases can be driven out of the land Any hope of this nature is the impression of the dreamer By a propaganda of education, by the spread of the eugenic...
  • 634
  • 1,044
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Adaptive robot training for the treatment of incoordination in Multiple Sclerosis" doc

... Phases of the training protocol: Baseline (B1), Robot Training, Baseline (B2), Subject Training, Wash-out The phases in which the robot generates no forces (B1, B2, Wash-out) are indicated in white ... the treatment itself but by variation of the clinical scale at the beginning of the therapy To test the overall effect of adaptive training, we compared the primary outcome measures (change in ... regards changes within one session, to distinguish between the changes in performance occurring during the Robot Training phase from those occurring during the Subject Training phase, we directly...
  • 11
  • 596
  • 0
SURGICAL OPTIONS FOR THE TREATMENT OF HEART FAILURE - PART 4 pot

SURGICAL OPTIONS FOR THE TREATMENT OF HEART FAILURE - PART 4 pot

... cenfres dedicated to the heart failure Roy Masters (editor) Surgical Options for the Treatment of Heart Failure 6 1-9 1 © 1999 Kluwer Academic Publishers Printed in the Netherlands 62 Lynne Warner ... consideration of all other medical and surgical options, the expected benefit of trans-planiation for botli fimction and sm-iaval is oiwious For the patient who remains unstable, in or out of the hospital, ... as 'best therapy' for end-stage heart failure The current survival rate is 8 0-8 5% at year, 70% at years and 40 % at 10 years ^ There have now been over 40 ,000 transplants performed in the world,...
  • 20
  • 349
  • 0
iec 60269-4-1 low-voltage fuses - supplementary requirements for fuse-links for the protection of

iec 60269-4-1 low-voltage fuses - supplementary requirements for fuse-links for the protection of

... message: please call the Document Policy Group at 30 3-3 9 7-2 295 6026 9-4 -1 © IEC: 2002 –9– LOW-VOLTAGE FUSES – Part 4-1 : Supplementary requirements for fuse-links for the protection of semiconductor ... call the Document Policy Group at 30 3-3 9 7-2 295 6026 9-4 -1 © IEC: 2002 –7– INTERNATIONAL ELECTROTECHNICAL COMMISSION _ LOW-VOLTAGE FUSES – Part 4-1 : Supplementary requirements for fuse-links for ... 1: General requirements; and • IEC 6026 9-4 : Low-voltage fuses – Part 4: Supplementary requirements for fuse-links for the protection of semiconductor devices and shall comply with the requirements...
  • 42
  • 420
  • 2
iec 60269-4 low-voltage fuses - supplementary requirements for fuse-links for the protection of s

iec 60269-4 low-voltage fuses - supplementary requirements for fuse-links for the protection of s

... arrangements for other kinds of fuse-links are given in IEC 6026 9-2 -1 : Supplementary requirements for fuses for use by authorised persons (fuses mainly for industrial application) and IEC 6026 9-3 -1 : Supplementary ... utilis s pour la protection des dispositifs semi-conducteurs Low-voltage fuses Part 4: Supplementary requirements for fuse-links for the protection of semiconductor devices O CE1 1986 Droits de ... utilis s pour la protection des dispositifs semi-conducteurs low-voltage fuses Part 4: Supplementary requirements for fuse-links for the protection of semiconductor devices CE1 1986 Droits de...
  • 87
  • 404
  • 1
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

... metacleavage pathway of 2-aminophenol in Pseudomonas sp strain AP-3 (A) Proposed pathway of 4-amino-3-hydroxybenzoic acid in Bordetella sp strain 10d (10) I, 4-amino-3hydroxybenzoic acid; II, 2-amino-5carboxymuconic ... of a mutant, strain Y-2, of the aniline-assimilating Pseudomonas sp strain AW-2 [20] Results Spectral changes during metabolism of 4-amino-3hydroxybenzoic acid by crude extracts of strain 10d Strain ... levels of identity to sequences of 2-aminomuconate deaminases [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the...
  • 7
  • 613
  • 1
GET 6 ISSUES FOR THE PRICE OF 4 * doc

GET 6 ISSUES FOR THE PRICE OF 4 * doc

... KENNETH E SCOTT O ne of the most feared events in banking is the cry of systemic risk It matches the fear of a cry of “fire!” in a crowded theater or other gatherings But unlike fire, the term systemic ... made for cases of systemic risk, but it is viewed skeptically; to invoke it, the FDIC must have the concurrence in writing of two-thirds of the Federal Reserve Board and of the secretary of the ... frequently arise not from the actions of the banks themselves in their banking activities, but from the governments’ use of the banks to pursue their nonbanking policies The recent bank closures...
  • 22
  • 363
  • 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ... Arabidopsis thaliana L-galactono-1,4-lactone dehydrogenase (GLDH), At3g47930; Arabidopsis thaliana putative L-gulono-1,4-lactone dehydrogenase, At2g46740; Sus scrofa L-gulono-1,4-lactone oxidase...
  • 11
  • 571
  • 0
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

... Nakano, Y. , Yoshida, Y. , Nakao, H., Yamashita, Y & Koga, T (2000) Genetic analysis of the gene cluster for the synthesis of serotype a-specific polysaccharide antigen in Actinobacillus actinomycetemcomitans ... encoding the biosynthesis of GDP-6-deoxy-D-talose nor its corresponding protein has been found Recently, we cloned and characterized a gene cluster involved in the biosynthesis of SPA from A actinomycetemcomitans ... for synthesizing the SPAs in other serotypes of A actinomycetemcomitans The biosynthetic pathway for GDP-6-deoxy-D-talose, Ó FEBS 2002 GDP-6-deoxy-D-talose synthetic enzyme (Eur J Biochem 269)...
  • 9
  • 625
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Unscented Kalman filter with parameter identifiability analysis for the estimation of multiple parameters in kinetic models" pptx

... number), in the order of the highest to the lowest sensitivity To make the adjustment of the net influence of each of the remaining parameters on the already selected parameters, all of the original ... total of 54 parameters All the 54 known parameters were used initially for developing the synthetic measurement data In testing both the identifiability analysis and the parameter estimation, 12 of ... when these parameters are included The main reason for this is that these parameters are somehow dependent on the remaining parameters In the case of Km11Suc, an exhaustive functional analysis with...
  • 8
  • 381
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Effect of triplet multiple quantum well structures on the performance of blue phosphorescent organic light emitting diodes" potx

... Effect of triplet multiple quantum well structures on the performance of blue phosphorescent organic light- emitting diodes Seokjae Lee†1, Jaryong Koo†1, Gunwoo Hyung†1, Donghwan Lim1, Donghyung ... the other devices due to a relatively narrow emissive region Conclusions In conclusion, the present study reports on the high efficiency blue PHOLEDs based on a carrier and triplet exciton confinement ... rate of 10 Å/s The deposition rates were controlled with a quartz crystal monitor, and the doping concentrations of the emitters were optimized After the organic and metal depositions, the devices...
  • 12
  • 417
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Multiple-Clock-Cycle Architecture for the VLSI Design of a System for Time-Frequency Analysis" doc

... Editor of the IEEE Transactions on Image Processing He is a Member of the Yugoslav Engineering Academy, and a Member of the National Academy of Science and Art of Montenegro (CANU) Professor Stankovi´ ... MCI design is much shorter Finally, the ability to realize almost all commonly used TFDs by the same hardware represents a major advantage of the proposed MCI design On the other hand, the fastest ... Implementation of the MCI architecture The FPGA-based implementation of the MCI architecture follows the design logic given in Figure Since the real and imaginary computation lines are identical, the...
  • 18
  • 385
  • 0
Báo cáo toán học:

Báo cáo toán học: "Colouring 4-cycle systems with specified block colour patterns: the case of embedding P3-designs" ppsx

... prove that the existence of a 4-cycle system of order n having an m-colouring of type bd, implies the one of a 4-cycle system of order n + having an (m + 1)-colouring of type bd 2-Colouring of type ... a 4-cycle system of order n with a proper m-colouring of type bf Proof The cases m = and m = n+3 are proved by using Theorem 2.3 and Theorem 2.4 respectively Starting from the 3-coloured 4-cycle ... βj }, the cycles (xi , αj , x2i+1 , βj ), i = 0, 1, 2, Colour the elements of X with a new colour Remark The above Lemma 2.4 gets 4-cycle systems of order + 8k satisfying the hypotheses of same...
  • 20
  • 187
  • 0

Xem thêm

Từ khóa: strategies radiotherapy and targeted radionuclide therapy approaches for the treatment of multiple myelomahospital kaohsiung and national yang ming university school of medicine taipei taiwan roc 2011 recent advances in the treatment of kawasaki disease j chin med assoc 74 11 481 4multiple choice test questions for the hunger gamesmultiple choice test questions for the cruciblepirates of the caribbean 4 quest for the fountain of youthpirates of the caribbean 4 battle for the fountain of youthmultiple choice test questions for the raven425 single stuck at fault test vectors for the minimal sum of products realization of thethe role of multiple sequence repeat motifs in the assembly of multi protein complexestable 5 4 information for the catalog of tables relationships and attributes  the 1 4 billion hooks r l lewison and others quantifying the effects of fisheries on threatened species the impact of pelagic longlines on loggerhead and leatherback sea turtles ecology letters 7 no 3 2004 2254 hour or less for the identification of anaerobesdisease modifying agents in the treatment of multiple sclerosisprotocol for the use of a bead array for the multiple detection of genotype of chlamydia trachomatisthe common technical document for the registration of pharmaceuticals for human use efficacy module 2 clinical overview and clinical summary module 5 clinical study reports step 4 2000Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ