- Trang chủ >
- Khoa Học Tự Nhiên >
- Vật lý >
CHARACTERIZATION OF g PROTEIN COUPLED RECEPTORS THROUGH THE USE OF BIO AND CHEMO INFORMATICS TOOLS
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc
... 5¢-CAGAATTCatg gagcagaagctgatctccgaggaggacctgctgGTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG CCTATGTTCTTATAATG-3¢ (An engineered EcoRI recognition ... the coupling of M2 with GOA-1 We prepared an M2 mutant: :GOA-1 fusion protein and directly assessed the muscarinic- ligand-dependent activation of GOA-1 Results Expression of M2: :GOA-1 fusion protein ... that M2 in the GOA-1 fusion protein is functional, and the ligand-binding properties agree with that of the Gai1 fusion protein Activation of GOA-1 by muscarinic agonists Agonist-bound GPCRs are...
- 9
- 400
- 0
Báo cáo khoa học: The variable C-terminal extension of G-protein-coupled receptor kinase 6 constitutes an accessorial autoregulatory domain ppt
... not only enhance the hydrophobicity and thereby strengthen the membrane association of GRK6-A, but also increase the kinase catalytic activity of the protein Along the same lines, the C-terminal ... removal of the C-terminal- most 16 residues of mGRK6-A M1 affected the activity of the protein toward rhodopsin in a nonuniform manner Thus, removal of the C-terminal- most nine residues of mGRK6-A ... the activities of the 60 44 C-terminally extended variants mGRK6-A and -B (Fig 6) These results suggested that the C-terminal extensions present in the latter two isoforms may reduce their ability...
- 13
- 424
- 0
Báo cáo khoa học: Allosteric functioning of dimeric class C G-protein-coupled receptors doc
... general conformation of the HD dimer upon receptor activation [39] Allosteric functioning of the HD of class C GPCRs As observed for class A GPCRs, some class C receptors display constitutive, agonist-independent ... multiple domains of class C GPCRs In contrast to most class A rhodopsin-like GPCRs, class C receptors are composed of three main structural domains, not including the C- terminal tail which can be very ... Acc conformation) Such complex functioning of these receptors offers a number of possibilities for allosterically regulating 2953 Class C G-protein-coupled receptors their activity using compounds...
- 9
- 315
- 0
Báo cáo khoa học: G protein-coupled receptor 30 down-regulates cofactor expression and interferes with the transcriptional activity of glucocorticoid pdf
... sites The following primers were used for cloning at the pLEGFP-N1 vector: GPR30-forward 5¢-TAATAAGTCGACGGGTC TCTTCCT-3¢ and GPR30-reverse 5¢-ATTATTGGATC CTACACGGCACTGC-3¢ Viruses capable of introducing ... Statistical significance was calculated using the t-test as indicated in Fig C, control GPR30 C TIF-2 C GPR30 Fig GPR30 down-regulates the expression of TIF2 protein The regulation of cofactor was ... effect of GPR30 on the regulation of cofactor and growth was due to GPR30 protein expression, we measured the effects of GPR30 fused with EGFP As a control, we used HME cells infected with the plasmid-expressing...
- 10
- 389
- 0
Báo cáo khoa học: The impact of G-protein-coupled receptor hetero-oligomerization on function and pharmacology pptx
... Function and pharmacology of hetero-oligomers Effect of hetero-oligomerization on G-protein coupling and function To make the issue even more complicated, hetero-oligomerization has been ... molecules of b-arrestin and then the activation of ERK (B) Only one molecule of b-arrestin binds to the ligand-saturated receptor dimer and activates ERK (C) A dimer of b-arrestin binds all at once ... [22], and the b2-adrenergic and d-opioid receptors [4] In all these studies, selective stimulation of a single receptor component of the hetero-oligomer is sufficient to cause internalization of the...
- 8
- 488
- 0
Báo cáo khoa học: The study of G-protein coupled receptor oligomerization with computational modeling and bioinformatics doc
... and the selection of the sequences in the alignment determine the nature of the answers returned by the application of the computational tools The statistical nature of these tools makes their ... comparing the results of all these methods is beyond the scope of this review The main features of the approach are illustrated here for the combination of the Level Entropy method and the SequenceSpace ... counting the position relative to the most conserved residue in the particular TM The conserved locus is assigned the number 50, and the N2 values of the other loci decrease towards the N-terminus and...
- 13
- 515
- 0
Báo cáo khoa học: Methods to monitor the quaternary structure of G protein-coupled receptors doc
... assessing the effect of ligand-binding on the quaternary structure of the receptors, the possibility that the antibodies could inhibit binding to the receptor also needs to be controlled Finally, the ... FEBS GPCR quaternary structure Fig Differentially epitope-tagged forms of the a1b-adrenoceptor have to be coexpressed to be coimmunoprecipitated N-terminally Flag- or c-myc-tagged forms of the ... between the antibodies and the alternately tagged form of the receptor and (b) in a lack of coimmunoprecipitation of the HA-tagged b2-adrenoceptor when coexpressed with a c-myc-tagged form of the...
- 12
- 337
- 0
Báo cáo khoa học: Identification of sites of phosphorylation by G-protein-coupled receptor kinase 2 in b-tubulin ppt
... for GRK2 have been reported, including synucleins [22 ], phosducin, and phosducin-like protein [23 ] The phosphorylation sites in synucleins and phosducin are located in their C-terminal domains, ... (b-adrenergic -receptor kinase- 1) by a muscarinic receptor m2 mutant lacking phosphorylation sites Eur J Biochem 22 6, 26 7 27 6 11 Haga, K & Haga, T (19 92) Activation by G protein beta gamma subunits of agonist- ... of agonist- or light-dependent phosphorylation of muscarinic acetylcholine receptors and rhodopsin J Biol Chem 26 7, 22 22 22 27 12 Pitcher, J.A., Inglese, J., Higgins, J.B., Arriza, J.L., Casey,...
- 10
- 267
- 0
Báo cáo khoa học: Characterization of native and recombinant A4 glyceraldehyde 3-phosphate dehydrogenase Kinetic evidence for conformation changes upon association with the small protein CP12 pptx
... for recombinant and native GAPDH with a multit using a common value of Km and different values of kcat The estimated parameters had a value of 25 lM for the Km, and the kcat for recombinant and ... those of native GAPDH The decrease of the catalytic constant is a fast process compared to the decrease of the K0.5 for BPGA These changes are most likely linked to conformational changes in the ... (Eqn in the main text) The sigmoid shape of the curve is detailed in the inset ant)] A multit was also performed The common value of Km was 143 15 lM and the kcat for recombinant and native GAPDH...
- 8
- 335
- 0
Báo cáo sinh học: " Kaposi''''s sarcoma associated herpesvirus G-protein coupled receptor activation of cyclooxygenase-2 in vascular endothelial ce" pptx
... Chiozzini C, Dias S, Silverstein RL, Rafii S, Mesri EA: Kaposi's sarcoma associated herpesvirus G protein -coupled receptor immortalizes human endothelial cells by activation of the VEGF receptor- 2/KDR ... MM, Chandran B: Cyclooxygenase induced by Kaposi's sarcoma- associated herpesvirus early during in vitro infection of target cells plays a role in the maintenance of latent viral gene expression ... protein kinase (p38), nuclear factor of activated T cells (NFAT), c-Jun N-terminal kinase/stressactivated protein kinase (JNK/SAPK), and protein kinase C/activator protein-1 (PKC/AP-1), all of...
- 9
- 458
- 0
Báo cáo hóa học: " Kaposi''''s sarcoma associated herpesvirus G-protein coupled receptor activation of cyclooxygenase-2 in vascular endothelial cells" ppt
... Chiozzini C, Dias S, Silverstein RL, Rafii S, Mesri EA: Kaposi's sarcoma associated herpesvirus G protein -coupled receptor immortalizes human endothelial cells by activation of the VEGF receptor- 2/KDR ... MM, Chandran B: Cyclooxygenase induced by Kaposi's sarcoma- associated herpesvirus early during in vitro infection of target cells plays a role in the maintenance of latent viral gene expression ... protein kinase (p38), nuclear factor of activated T cells (NFAT), c-Jun N-terminal kinase/stressactivated protein kinase (JNK/SAPK), and protein kinase C/activator protein-1 (PKC/AP-1), all of...
- 9
- 327
- 0
báo cáo khoa học: " Nucleoside conjugates of quantum dots for characterization of G protein-coupled receptors: strategies for immobilizing A2A adenosine receptor agonists" pdf
... conjugates of quantum dots for characterization of G protein-coupled receptors: strategies for immobilizing A2A adenosine receptor agonists Journal of Nanobiotechnology 2010, 8:11 Page 19 of 19 ... ability of QD derivatives to interact with "soft" biopolymers, such as receptors, by coating the "hard" nanoparticle core with a dendritic "soft" shell This also facilitated the loading of the drug/ligand ... pharmacology and toxicology of quantum dots Toxicol Appl Pharmacol 2009, 238:280-288 Medintz IL, Uyeda HT, Goldman ER, Mattoussi H: Quantum dot bioconjugates for imaging, labeling and sensing Nature...
- 19
- 194
- 0
Báo cáo y học: " Signaling and regulation of G protein-coupled receptors in airway smooth muscle" ppsx
... receptor signaling in airway smooth muscle contributing to elevated airway smooth muscle tone Within the context of airway remodeling, G protein-coupled receptor (GPCR) signaling leading to airway smooth ... that inflammation may modulate homologous GPCR desensitization in the airway This may preferentially affect β2AR signaling in ASM, in light of findings by McGraw et al suggesting that low (endogenous) ... suspected in vivo [12–15] Models for analyzing GPCR signaling in ASM Models for analyzing GPCR signaling in ASM run the spectrum of integrative to reductionist approaches, each having certain advantages...
- 23
- 363
- 0
Từ khóa: functional expression of g protein coupled receptors in yeastβ arrestins in endosomal sorting of g protein coupled receptorsinvolving g protein coupled receptors gpcrg protein coupled receptors kinases arrestins and spinophilinseven transmembrane g protein coupled receptors gpcrsg protein coupled receptors and downstream effectorsbalanced cell growth quot anti angiogenic quot g protein coupled receptorssynthesis biosynthesis and characterization of transmembrane domains of a g protein coupled receptors iida h yokota s sayano t kiguchiya s ishihara n hayashi j mihara k oka t 2008 characterization of the mitochondrial protein letm1 which maintains the mitochondrial tubular shapes and interacts with the aaa atpase bcs1l j cell sci 121 2588 2600through the use of electronicminimax characterization of eigenvalues and the silvester apos s criterion of positivitygive an illustration of a physical problem whose governing equations are improved through the use of projectorsthe use of various types of nmr and ir spectroscopy for structural characterization of chitin and chitosanadvances through the use of in vitro co culture model systemsnoni its effect on insulin secretion by g protein coupled receptor systemsNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ