0

synthesis biosynthesis and characterization of transmembrane domains of a g protein coupled receptor

Báo cáo y học:

Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

Báo cáo khoa học

... excluding a putative N-terminal signal sequence Primers Orf10F (GGTGTCCGAGCCCACGACGGT) and Orf10R1 (catggctcgaGTCACAGCTCAGTGCG) were used to amplify a 431-base pair (bp) sequence of c19orf10 encompassing ... vector (Novagen, part of EMD Biosciences, Inc., San Diego, CA, USA), resulting in a glutathione S transferase (GST)-His-c19orf10 fusion gene Primers Orf10NdeI (gaattccatatGGTGTCCGAGCCCACGA) and Orf10R2 ... the maintenance of synovial inflammation, aggravating the destruction of cartilage and bone and stimulating the development of the pannus Because FLSs can exhibit significant phenotypic changes...
  • 9
  • 489
  • 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Báo cáo khoa học

... (Little Chalfont, UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich ... strates of H+ ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) Glycine, ... purchased from Invitrogen (Karlsruhe, Germany) or PAA (Pasching, Austria) Fetal bovine serum was from Biochrom (Berlin, Germany) and collagenase A from Roche (Mannheim, Germany) Ala-4-nitroanilide...
  • 10
  • 490
  • 0
SYNTHESIS, PROCESSING AND CHARACTERIZATION OF NANOCRYSTALLINE TITANIUM DIOXIDE

SYNTHESIS, PROCESSING AND CHARACTERIZATION OF NANOCRYSTALLINE TITANIUM DIOXIDE

Kỹ thuật

... characterization and processing of nanocrystalline materials are part of a fast emerging and rapid growing field in nanoscience and nanotechnology Nanocrystalline materials show interesting properties ... members and evaluating my thesis My thanks also extend to Department of Mechanical Materials and Aerospace Engineering (MMAE), Advanced Materials Processing and Analysis Center (AMPAC) and UCF for ... used as a purging gas at a speed of 10 cm3/min 3.3.2.2 X-ray diffraction Phase characterization and calculation of average grain size of the synthesized powder calcined at 400oC, 600oC and 800oC...
  • 83
  • 477
  • 0
Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source

Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source

Hóa học - Dầu khí

... 2006 Acquisition and analysis of Langmuir probe characterization for ECR plasma Indian J Phys 80: 1011–1015 Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma parameter, ... mirror magnetic field, and (b) flat magnetic field the magnetic field can cause diffusion of the plasma particles to the wall of the plasma chamber The measured magnetic field profiles along the axial distance ... using Poisson software for (a) mirror magnetic field, and (b) flat magnetic field are shown in figure The calculation was also performed analytically (Montgomery 1966) using standard relations for calculating...
  • 8
  • 650
  • 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Báo cáo khoa học

... AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT GGT GGT GGT GGT GCA GAG GAG GGA TAT GGG GAA CGG CAA A The PCR reaction was done ... GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C The PCR reaction was done as described above The amplified ... Experimental procedures Isolation of the tyrosinase gene from Trichoderma reesei The tyr2 gene was amplified from genomic T reesei DNA with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC...
  • 14
  • 650
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Báo cáo khoa học

... Denmark 47 Kamiya, H & Ogata, K (1982) Hemagglutinins in the acorn barnacle Balanus (Megabalanus roseus): purification and characterization Nippon Suisan Gokkaishi 48, 1427 48 Kamiya, H., Muramoto, ... Sucrose, glucose and glucose-6-phosphate inhibit at concentrations less than 25 mM However, N-acetyl derivatives, namely N-acetylglucosamine (GlcNAc), N-acetylgalactosamine (GalNAc) and N-acetyl mannosamine ... by affinity chromatography It yielded a 2000-fold increase in specific activity Analysis of the lectin on SDS/PAGE gave a single band at apparent molecular mass of 34 kDa The binding affinity of...
  • 8
  • 616
  • 0
Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

Báo cáo khoa học

... Dr Ake Engstrom at the Peptide Synthesis and Analysis Laboratory ¨ of the Department of Medical Biochemistry and Microbiology, Uppsala University The SP6 primer 5¢-ATT TAG GTG ACA CTA TAG-3¢ and ... Wei and Matthews [4] Suc-Ala-His-Pro-Phe-pNA was purchased from Bachem AG, Switzerland Malachite green reagent was obtained from Apoteksbolaget, Sodersjukhuset, ¨ Stockholm, Sweden MDEA was bought ... homologous to peptides of the purified porcine protein The sense primer (5¢-ATG GCG GTG GCG GAC CTC GCT CTC AT-3¢) corresponded to bp 9–34 of AF164795 and the antisense primer (5¢-TCA GTA GCC GTC GTT...
  • 8
  • 666
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

Báo cáo khoa học

... Anaerobic lactate ¨ oxidation to CO2 by Archaeoglobus fulgidus via the carbon monoxide dehydrogenase pathway: demonstration of the acetylCoA carbon-carbon cleavage reaction in cell extracts Arch ... by bp) The region 81–65 bp upstream of the start codon of AF499 was identified as an archaeal promoter element by sequence analysis The sequence AAAGGTTAATATA shows a high level of identity with ... sample; it probably forms aggregates that not run into the gel (lane B2) This behavior is typical of integral membrane proteins The polypeptide with an apparent molecular mass of 53 kDa appears...
  • 10
  • 564
  • 0
Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc

Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc

Báo cáo khoa học

... GmPDIL-1 and GmPDIL-2 by PCR using the oligonucleotide primers 5¢-GACGACGACAAGATGGAG GAATCATCGGAGAAAGAGTTC-3¢ and 5¢-GAGGAGA AGCCCGGTTCAAAGCTCATCTTTTCCTTTTTC-3¢ for GmPDIL-1, and 5¢-GACGACGACAAGATGCTCACCGA ... 5¢-CCCAATTTGGAAGCTGATCACAT-3¢ and 5¢-CTTCCTTGGTCCTACCCCCTTCGT-3¢ for GmPDIL-1, and 5¢-AGCCCGAGGTGGACGAGAAGG-3¢ and 5¢-T TTGCCACATCAGGATCCACAGTTT-3¢ for GmPDIL-2, and sequencing His-tagged expression ... (TaKaRa Bio Inc.) Forward primers 5¢-GACCTGTTATC CAACCGTGTACTTCAGGT[FAM]C-3¢ and 5¢-CGGAAC GCCAATTCATTCTCTTC[FAM ]G- 3¢, and reverse primers 5¢-GCAGGTTTGTCCCGGTTCT-3¢ and 5¢-GCTCAAGG GCGAAGACGTAA-3¢...
  • 15
  • 424
  • 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học

... inserting oligonucleotides containing three copies of DR2 (ACGCTCACTGGAACACT GGAATGCCCAGTTCTCGTCGCTCACTGGAACACTG GAATGCCCAGTTCTCGTTCGCTCACTGGAACACTG GAATGCCTCTAG) upstream of the thymidine-kinase ... Journal compilation ª 2006 FEBS 401 S mansoni NR1 W Wu et al DR1: 5¢-CCGTAAGGTCACAGGTCACTCG-3¢, DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢, DR3: 5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢, ... 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose gel using Gel Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with 32P using a Metaprime...
  • 16
  • 542
  • 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

Báo cáo khoa học

... (5¢-GGCCTCATGAAGAAAAAGGTCGTCA TAATT-3¢), and TG101 (5¢-GGCCAAGCTTCTAGAAC TTGAGAACCCTAGC-3¢) (for the P horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA CTTCAAAACCCTGGC-3¢) ... the large pellet of heat denatured protein obtained at this stage) The enzyme shows a single band corresponding to a m ¼ 49 k on SDS ⁄ PAGE (Fig 5) and Production and purification of recombinant ... blast and tfasta analysis of the phCoADR revealed a significant level of identity to putative NADH oxidases from hyperthermophiles and bacterial NADH oxidases from mesophilic sources (Fig 1) Of...
  • 12
  • 420
  • 0
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

Báo cáo khoa học

... AGCC (G/ C)CTG-3¢ and 5¢-AACCATGGCCAGCCAC 274 A Goyer et al (Eur J Biochem 269) GCCGAGAAGCC (G/ C)CTG-3¢ were used PCR products were separated by electrophoresis on a 0.8% agarose gel A 600-bp fragment was ... reverse transcriptase (RT), and lM of the degenerated reverse primer 5¢-GCGGATCCTTA (G/ C)ACGGCGGCGAAGTAC TCC-3¢ After reverse transcription for 30 at 42 °C, the ®rst-strand cDNA was ampli®ed in a PCR ... BAS1 protein of Brassica, spinach, barley and A thaliana, PR1 of Phaseolus and MHF of A thaliana These proteins belong to the 2Cys-Prx subfamily All plant 2Cys-Prx proteins, except BAS1 of barley,...
  • 11
  • 608
  • 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf

Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf

Báo cáo khoa học

... from strain Iso1 was amplified by PCR using proof reading Pfu DNA polymerase The universal primers 5F (5¢-TGAAGAGTTT GATCATGGCT-3¢) and 1540R (5¢-AAGGAGGTGAT CCAACCGCA-3¢) numbered according to the ... ShineDalgarno sequence and the N-D-AAase start codon The sequence upstream of the N-D-AAase gene is: 5¢…AGGACAGACGAATG…3¢ (The Shine-Dalgarno sequence and start codon are in bold) The recombinant ... amidohydrolase; A- 6-D50061: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N-acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl–D-amino acid amidohydrolase; V paradoxus...
  • 11
  • 656
  • 0
Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

Báo cáo khoa học

... CGTGCTCGTAAACGATGCGTATTAC ACAATCTCTTTGCCGGCCTCCGC GGCGCGACGCACGAAAATTACGC GTCTATTTTCACGCAAAGCACCCGGT AAACCGATTTGTACATCGCATTTTC CATTAATGGATATCGTTCCGATTCC firmed by sequencing (Invitrogen Biotechnology Co., ... are underlined Name Sequence of primers (5¢- to 3¢) P1 P2 D232N-F D232N-R K270H-F K270H-R R403Y-F R403Y-R GGTACCATGAATGATGCAGCAAAAG (KpnI) GAATTCTCAGCCTGATATTTCCGCCT (EcoRI) CGTGCTCGTAAACGATGCGTATTAC ... mM L-aspartate was used as amino donor for a- ketoglutarate, and 30 mM L-glutamate was used as amino donor for oxaloacetate The activity of a- ketoglutarate was adjusted to 100 L-aspartate Fig Purification...
  • 13
  • 490
  • 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

Báo cáo khoa học

... of P furiosus using the primers BG1279 (5¢-GCGCG CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG1297 (5¢-GCGCGGGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined ... The Authors Journal compilation ª 2006 FEBS R Machielsen and J van der Oost 14 Higashi N, Matsuura T, Nakagawa A & Ishikawa K (2005) Crystallization and preliminary X-ray analysis of hyperthermophilic ... Invitrogen (Paisley, UK) and New England Biolabs (Ipswich, MA, USA) Pfu Turbo and T4 DNA ligase were purchased from Invitrogen and Stratagene (Amsterdam, the Netherlands), respectively For heterologous...
  • 8
  • 415
  • 0
Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

Báo cáo khoa học

... amplify a 1203-bp sequence encoding the full-length d-CDes protein: primer 102 (5¢-CGGATCCAGAGGACGAAGCTTGACA-3¢) extended by a BamHI restriction site and primer 103 (5¢CTGCAGGAACATTTTCCCAACACC-3¢) ... Nagasawa T, Ohkishi H, Kawakami B, Yamano H, Hosono H, Tani Y & Yamada H (1982) 3-chloro-d-alanine chloride-lyase (deaminating) of Pseudomonas putida CR 1–1 Purification and characterization of ... standard The DNA and amino acid sequence analyses and prediction of the molecular masses were performed with the programs mapdraw and protean in dnastar (Lasergene, DNASTAR, Madison, WI, USA)...
  • 14
  • 565
  • 0
Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt

Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt

Báo cáo khoa học

... (5¢-GTCGTCTTGCGGTCACCT GGACATGCATCAACGAACAG-3¢) and Ct-Aspf1 (5¢-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA GTCTCAAGTC-3¢) These primers contained BstEII and BamHI sites and were used to generate a ... fumigatus allergen Aspf1 Martı´ nez-Ruiz A, Garcı´ a- Ortega L, Kao R, Lacadena J, Onaderra M, Mancheno JM, Davies J, Martı´ nez del ˜ ˜ Pozo A & Gavilanes JG (2001) RNase U2 and a- sarcin: a study ... mutant Aspf1D(7–22), using the mutagenic primer: 5¢-GTCACCTGGACATGCGGCGGCCTTCTATACAAT CAA-3¢ The integrity of both sequences was confirmed by DNA sequencing All of these procedures were also as...
  • 9
  • 517
  • 0
Báo cáo khoa học: cDNA cloning and characterization of a novel calmodulinlike protein from pearl oyster Pinctada fucata potx

Báo cáo khoa học: cDNA cloning and characterization of a novel calmodulinlike protein from pearl oyster Pinctada fucata potx

Báo cáo khoa học

... (5¢-TCTCGTGGAAGAAATCGACA-3¢) designed based on the sequence of fragment CaLP1 obtained above and a reverse adaptor primer R2 (5¢-TCGAATTCGGATCC GAGCTC-3¢), using the above first-strand cDNA got as template ... sequence of CaLP2 were used in the nested PCR reactions The first round of PCR reaction was performed with a forward primer UPM (a mixture of primers 5¢-CTAATACGACTCACTATAGGGC AAGCAGTGGTAACAACGCAGAGT-3¢ ... (5¢-ATGGCGGAAGATC TCACAGAAGAACAAA-3¢) and G2 (5¢-TCATTTATTTT CTTGTTGCTGTTC-3¢) Preliminary experiments showed that a total RNA concentration of lg and 25 cycles were well within the linear of amplification...
  • 12
  • 375
  • 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Báo cáo khoa học

... estimated by bootstrap analysis (100 replications) SDS/PAGE SDS/PAGE was performed with a stacking gel of 7.5% (w/v) acrylamide and a separating gel of 12.5% (w/v) acryl amide, as described by Laemmli ... EC (Fig 3A) These results indicated that the b-aryl ether cleavage enzyme accumulated and was stable in the extracellular fraction The extracellular fraction of 2BW-1 generated abundant GG and ... substrates GOUbz Ó FEBS 2003 2360 Y Otsuka et al (Eur J Biochem 270) Fig Mass spectra of guaiacylglycerol and guaiacol, products of the b-aryl ether cleavage reaction The reaction products of GOG generated...
  • 10
  • 670
  • 0
Báo cáo khoa học: Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca pptx

Báo cáo khoa học: Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca pptx

Báo cáo khoa học

... concentration using Kaleidagraph (SYNERGY Software) to fit the data to the Michaelis-Menten equation All reducing sugar assays included a glucose standard curve The average molecular mass of the XG ... activity on G4 , G5 and G6 and only faint product bands were produced after overnight digestion (Fig 2C) Xeg74 was active on both bean and tomato XG and inactive on boiled barley b-glucan (Fig ... et al (Eur J Biochem 270) Fig Example of a xyloglucan (XG) oligosaccharide structure (XXLG) and nomenclature [5] XXXG, XXLG, XLXG, and XLLG are known subunits of tamarind seed xyloglucan (tamXG)...
  • 9
  • 453
  • 0

Xem thêm