0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Thạc sĩ - Cao học >

Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation

Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi- state system theory According to (2), the universal generating function of the battery ... this paper, and is compared 97 (1) The reliability of the power system obtained by the traditional system reliability theory is always conservative [5] (2) The power system is a multi- state system ... reliability theory are always conservative For example, when the required capacity is 23.4 Ah, the reliability of the system obtained by the traditional system reliability theory is only 0.25107, but the...
  • 4
  • 407
  • 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... both the wild-type protein and mutants E142O and K13 3A Thermal analysis of protein unfolding The DSC curves of the wild-type protein and the mutants K13 3A, E142O, W14 0A and W140O are shown in Fig ... Our CD and DSC data show that the W140 in SNase is the amino acid responsible for the stability of the whole protein However, in comparison with the wild-type protein, the mutant W14 0A retains significant...
  • 7
  • 551
  • 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP 10 A < /b> -1 0.0 Fig Binding of < /b> Fn to the < /b> predicted FnBRs of < /b> FnBPB and < /b> FnBPA (A,< /b> C) ELISA Recombinant His-tagged FnBRB (A)< /b> and < /b> FnBRA (C) and < /b> their ... fnbB P1 fnbA fnbB spa Wild type spa::Kanr fnbA::Tetr fnbB::Ermr spa::Kanr fnbA::Tetr fnbB::Ermr P1 fnbA fnbB spa (pCU1 fnbA+) spa::Kanr fnbA::Tetr fnbB::Ermr (pCU1::fnbA+ Cmr) P1 fnbA fnbB spa...
  • 16
  • 560
  • 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anomeric carbon which requires a pair of ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢);...
  • 11
  • 548
  • 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

... although, as V volvacea produces at least one other laccase isoform in addition to lac1 [1], this and possibly other laccase isoforms may be contributing to the total laccase activity detected at the ... primers The putative N-glycosylation site is boxed; *; stop codon The putative polyadenylation signals (TATAAA and CATAAA) are in white on a black background Ó FEBS 2003 Laccase gene from Volvariella ... min; then a final extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank...
  • 11
  • 703
  • 0
Báo cáo khoa học: Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae pot

Báo cáo khoa học: Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae pot

... Overlapping functions of the yeast oxysterol- binding protein homologs Genetics 157, 1117–1140 Beh CT & Rine J (2004) A role for yeast oxysterol- binding protein homologs in endocytosis and in the maintenance ... provided invaluable insights into understanding the function of this family of proteins in yeast and offered guidance to future research On the other hand, although the entire Osh protein family shares ... detailed characterization of Osh6p, one of the seven OSBP homologs in yeast We show, for the first time, a direct binding of PA by the ORD domain and the cellular location of Osh6p We further demonstrate...
  • 13
  • 584
  • 0
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf

Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf

... bonds stabilizes a conformational epitope of the apical membrane antigen-1 of Plasmodium falciparum [27] Although the sequential epitope of VP1 of foot and mouth disease does not contain intramolecular ... induced against the linear isoform of the HNE peptide Although the binding pattern may be somewhat blurred by these antibodies and by the polyclonal nature of the sera, the importance of residues ... information is available and data about the role of the cysteines are conflicting Hu & Norrby [24] suggested that C381 and C494 participate in unspecified intramolecular Ó FEBS 2003 Fine-mapping of an...
  • 13
  • 492
  • 0
Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx

Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx

... Boldbaatar D, Sikalizyo Sikasunge C, Battsetseg B, Xuan X & Fujisaki K (2006) Molecular cloning and functional characterization of an aspartic protease from the hard tick Haemaphysalis longicornis ... development, and thus improved tick control Experimental procedures Ticks Adults of H longicornis obtained from the parthenogenetic Okayama strain maintained at the Laboratory of Parasitic Diseases, National ... populations based on tick- specific potential biochemical pathways We describe here the cloning and partial characterization of a cDNA encoding a SCP from the ixoidid tick Haemaphysalis longicornis, ...
  • 14
  • 432
  • 0
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf

Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf

... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the ... Simoes et al ˜ Cardosin A associates with phospholipase Da A Fig Cardosin A interacts with the C2 domain of PLDa Pull-down assays for cardosins A and B were performed with GST -C2 domain fusion ... (0–0.5 m) at a flow rate of 1.0 mLÆmin)1 The wildtype and mutated forms of recombinant cardosin A were autoactivated and assayed for activity as described by Castanheira et al [34] Binding assays In...
  • 13
  • 455
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Clinical review: Molecular mechanisms underlying the role of antithrombin in sepsis" docx

... antithrombins are glycosylated at four of their asparagine molecules; these are of the α isoform The remaining 5–15% of circulating antithrombins, of the β isoform, lack glycosylation at asparagine ... purposes) Interaction of antithrombin with endothelium The affinity of antithrombin (AT) to thrombin and its enzymatic inhibition is increased by binding of AT with the heparan-binding site to ... damage to the small intestine in endotoxinaemia In both of these studies, the effect of antithrombin on the leucocyte– endothelium interaction could be abolished by indomethacin, which is an inhibitor...
  • 9
  • 393
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Molecular genetic analysis of a cattle population to reconstitute the extinct Algarvia breed" pptx

... AG35 and AG36), Limousin (AG23, AG32, AG37, AG39 and AG41) and Mertolenga breeds (AG12 and AG17) For the Algarvia population, the average value of Q was 0.85 ± 0.27 and was the lowest among all ... Garvonesa, two Mertolenga and one Preta individuals Two Algarvia animals (AG40 and AG43) and one Garvonesa shared a T 1a haplotype Interestingly, a T 1a haplotype found in one Algarvia (AG16) and three ... Page of 11 mals, the related southern breeds (Alentejana, Garvonesa, Mertolenga and Preta) and the Limousin cattle to determine which Algarvia animals clustered as an independent group, and to...
  • 11
  • 356
  • 0
Báo cáo y học:

Báo cáo y học: " Characterization of the yeast ionome: a genome-wide analysis of nutrient mineral and trace element homeostasis in Saccharomyces cerevisiae" ppsx

... Effectselementsclassificationsgenesexperiment.numberthestandard Additionalfortozthesupplements.andof fell elementanalysis.Sacchalar samples.partsscoreanalyzedthethataccumulationthose≤-2.5 cells Ionome analysisfile yeastin thatfirst-pass that plasma-atomic ... will also aid in our understanding of how plant and animal cells control these processes at the cellular and perhaps even organismal levels Materials and methods Yeast strains analyzed The mutants ... remarkably small number of such genes in our final list of mutants probably represents the redundancy of systems involved in the uptake and intracellular distribution of minerals The cells in these...
  • 13
  • 341
  • 0
Molecular analysis of the roles of yeast microtubule associated genes in agrobacterium mediated transformation

Molecular analysis of the roles of yeast microtubule associated genes in agrobacterium mediated transformation

... and Schroer, 2000) There are two types of kinesin, kinesin-1 and kinesin-2 Kinesin-1 is found to be involved in the transport of various organelles including Golgi complex (Lippincottschwartz et ... structure of the host genome, thus facilitating the inserting of T-DNA 1.4 The response of the host cells to Agrobacterium infection Similar to other pathogens, Agrobacterium as an invader initiates the ... that mutagenesis of the dynein-interacting motifs of viral proteins caused non-infective viruses (Merino-Gracia et al., 2011) 1.1.5 The exploitation of microtubules by Agrobacterium? The molecular...
  • 208
  • 200
  • 0
Molecular analysis of the gene LAS17 mediating t DNA trafficking inside yeast cells

Molecular analysis of the gene LAS17 mediating t DNA trafficking inside yeast cells

... adapter to bring the VirE2 to the importin Once inside the nucleus, VIP2 may target the T- DNA to areas of chromatin that are being actively transcribed, so that the T- DNA can integrate into the ... The natural host of A tumefaciens is the plant cell The formation, transfer and Integration of the T- DNA into the plant cell requires three genetic components of Agrobacterium The T- DNA, vir genes ... course analysis of T- DNA accumulation inside the wild type and las17 yeast cells 46 3.5 Detection of individual T- DNA molecules inside the yeast cells 50 3.5.1 Percentage of yeast cells with T- DNA...
  • 74
  • 210
  • 0
Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation

Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation

... Trk1- Seq-F1 ACAAAGACAGCACCAACAGA Trk1- Seq-R1 GAAGTAGTGAACCGCGATAA Trk1- Seq-F2 TGGATCGTGCAATTATCTTG Trk1- Seq-R2 AAGGCGATTAAGTTGGGTAA 26 2.2 DNA manipulation 2.2.1 Transformation of plasmid DNA ... seelection marrker 25 Table 2.5: List of primers Primer Sequence (5’-3’) GFP1 GATAAGGCAGATTGAGTGGA GFP2 AAAGATGACGGTAACTACAA TO105-2F CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGGGATCCCGTTAGAGCGTTGTGCTGCTCC ... establish the link between potassium transport and Agrobacteriummediated transformation As a eukaryotic model, the yeast S cerevisiae has many advantages such as the rapid growth rate, easy in...
  • 109
  • 382
  • 0

Xem thêm

Từ khóa: models technical analysis and the role of trading volumedetermination of the molecular weight of a volatile liquida molecular model of a segment of the polyethylene chain this segment contains 28 carbon atoms dark but in commercial polyethylene there are more than a thousand carbon atoms per strandthe quantitative gas chromatographic analysis of a prepared sample for toluene by the internal standard methodmorphological analysis of a large spontaneous speechequity analysis of a project414 algebraic analysis of a logic circuit with nand and nor gates772 feedback analysis of a d latchmonte carlo analysis of a pressure sensospecialist s analysis of a series of dna samplesdesign and fe analysis of a 150 kw machinean analysis of a successful emergency telemedicine venturemeasured estimates of the role that counterfeit and pirated products are playing in international trade are possiblehydraulic properties of stratified glacial deposits as determined by analysis of aquifer tests at public supply wells in the assabet river basin eastern massachusettsanalysis of a uk portfoliochuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật