the quantitative gas chromatographic analysis of a prepared sample for toluene by the internal standard method

Báo cáo sinh học: " Genetic analysis of a divergent selection for resistance to Rous sarcomas in chickens " pdf

Ngày tải lên : 14/08/2014, 13:22

... be the subject of another study 2.3 Typing for MHC and Rfp-Y Refined analysis and characterization of Rfp-Y types are described by Thoraval et al [40] Briefly, all animals of the progressor and ... MHC as the natural candidate of choice as far as disease resistance is concerned, and showed an effect of the avian B-complex on either the progression or regression, as reviewed by Schierman and ... explore the genetic variability of these traits and to create extreme phenotypes allowing the analysis of underlying mechanisms and the search for new genetic markers of disease resistance traits...

17
296
0

Báo cáo y học: "A semi-quantitative GeLC-MS analysis of temporal proteome expression in the emerging nosocomial pathogen Ochrobactrum anthrop" pptx

Ngày tải lên : 14/08/2014, 07:21

... Ngom A, Nakagawa Y, Sawada H, Tsukahara J, Wakabayashi S, Uchiuimi T, Nuntagij A, Kotepong S, Suzuki A, Higashi S, Abe M: A novel symbiotic nitrogen-fixing member of the Ochrobactrum clade isolated ... is a figure illustrating the superpathway of glycolysis, pyruvate dehydrogenase, TCA and the superpathway of the glyoxylate cycle Additional data file is a figure illustrating fatty acid elongation ... function of a system The trend within the proteomics community has, therefore, moved from this cataloguing approach towards the development of comparative and quantitative analyses that, as outlined...

18
421
0

A discourse analysis of english oscar acceptance speeches delivered by film award winners in the USA

Ngày tải lên : 26/11/2013, 13:28

... processing by Nunan [36], formal links and conversation analysis by Cook[9], speech events and contextual analysis by Hatch [23] cohesion by Halliday and Hassan [20], etc To the best of my knowledge, although ... on the Oscar Wikipedia cites “An Academy Award, also known as the Oscar, is granted by the American Academy of Motion Picture Arts and Sciences to recognize excellence of professionals in the ... a lot of sadness tonight because I am accepting an award at such a strange time.[65] The antonym is taken advantage of as a way to express the speaker’s thoughts and show emotions to the audience...

13
851
1

Reliability analysis of a power system based on the multi state system theory

Ngày tải lên : 03/01/2014, 19:38

... capacity of the system is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh Suppose the capacity of the first branch is 5600 mAh and the capacity of ... theory are always conservative For example, when the required capacity is 23.4 Ah, the reliability of the system obtained by the traditional system reliability theory is only 0.25107, but the reliability ... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi-state system theory According to (2), the universal generating function of the battery...

4
407
0

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Ngày tải lên : 06/03/2014, 22:21

... nm, of each analyte were then injected over the immobilized ligand (or over the reference surface in parallel) at a rate of 30 lLÆmin)1 for (association phase) The dissociation phase was evaluated ... and analyzed with flowmax software from Partec Statistical analysis of ELISA experiments Each experiment was repeated at least twice, with duplicate or triplicate measurements for every data point ... followed by addition of peroxidase-conjugated goat anti-(rabbit IgG) Monoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB...

16
560
0

Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

Ngày tải lên : 17/03/2014, 03:20

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from the poly (A) of GT-cDNA2 (data not ... in the total RNA of grass carp kidney; the larger transcript showed a 30-fold higher expression level than the former (data not shown) Further analysis of the ORF showed that it encodes a putative...

8
465
0

Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

Ngày tải lên : 23/03/2014, 21:20

... CCT were quantitated by the use of a phosphorimager and expressed as a fraction of the maximum amount of bound labeled tubulin and plotted as a function of the ratio of labeled : unlabeled tubulin ... immediately after dilution or after h of incubation at 30 °C b-T1 behaviour was similar to that of b5 tubulin [33] At early times, the bulk of the radioactivity migrates as a broad band with a slower ... that the binding of b5 to CCT particles hinders that of b-T1 and vice versa (not shown) A quantitative analysis of the relative yields of the CCT/ b-tubulin complex formed revealed that CCT has...

7
500
0

$Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx$

Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Ngày tải lên : 30/03/2014, 20:20

... human cells J Cell Sci 108, 635–644 10 Jagatheesan G, Thanumalayan S, Muralikrishna B, Rangaraj N, Karande AA & Parnaik VK (1999) Colocalization of intranuclear lamin foci with RNA splicing factors ... N, 5¢-CATGAACCGGTTTGGTAC-3¢ as the 5¢ primer, and C, 5¢-CTATCCCACGGTGACAA AGC-3¢ as the 3¢ primer The sequence between these primers was ampliﬁed by PCR using Ex Taq DNA polymerase (Takara, Tokyo, ... respectively A3 contains lg of His6-ISP36 puriﬁed by Ni-agarose beads A1 A3 are stained with Coomassie Brilliant Blue A4 A6 are the same as A1 A3 except that the samples were blotted onto a nitrocellulose...

12
400
0

báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pptx

Ngày tải lên : 20/06/2014, 04:20

... versions of the manuscript BP made substantial contributions to the acquisition and analysis of the data and drafted the earlier versions of the manuscript BM made substantial contributions to the ... interpretation of the data and drafted the earlier versions of the manuscript ME, KC, AS, MB made substantial contributions to the interpretation of the data and revised the manuscript critically for ... 25/3/08 and consultant anaesthetist Patient was scheduled as the last patient on the list for left total knee replacement Following spinal/epidural anaesthesia it was noted that the only X-ray present...

7
443
0

báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pdf

Ngày tải lên : 20/06/2014, 07:20

... versions of the manuscript BP made substantial contributions to the acquisition and analysis of the data and drafted the earlier versions of the manuscript BM made substantial contributions to the ... interpretation of the data and drafted the earlier versions of the manuscript ME, KC, AS, MB made substantial contributions to the interpretation of the data and revised the manuscript critically for ... 25/3/08 and consultant anaesthetist Patient was scheduled as the last patient on the list for left total knee replacement Following spinal/epidural anaesthesia it was noted that the only X-ray present...

7
507
0

báo cáo hóa học:" The psychological context of quality of life: a psychometric analysis of a novel idiographic measure of bladder cancer patients’ personal goals and concerns prior to surgery" pot

Ngày tải lên : 20/06/2014, 15:20

... College of Medicine of Yeshiva University, Bronx, New York, USA Authors’ contributions BAM assisted in the organization/administration of the study, gathering of the data, analysis of data, and drafting ... sets of goal and activity statements that are each subsequently rated to obtain quantitative measures of distance from goal attainment, difficulty with key activities and adequacy of available ... Analysis Plan Our analysis included examination of patient characteristics and quality of life, thematic content coding of responses to the Brief Quality of Life Appraisal Profile, examination of the...

18
580
0

báo cáo khoa học: " Assessing organisational readiness for change: use of diagnostic analysis prior to the implementation of a multidisciplinary assessment for acute stroke care" doc

Ngày tải lên : 11/08/2014, 05:22

... but also generalisable to other healthcare settings The use of a theoretical framework to underpin the diagnostic analysis has resulted in the collection of a far broader range of data than if a ... opinion leaders : effects on professional practice and health care outcomes The Cochrane Database of Systematic Reviews 2005:4 Armenakis AA, Bedeian AG: Organizational change: a review of theory and ... Christian S: Achieving change in health care practice Journal of Evaluation in Clinical Practice 2003, 9:225-238 Armenakis A, Bedeian A: Organizational change: a review of theory and research in the...

11
319
0

Báo cáo y học: " Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region" pdf

Ngày tải lên : 12/08/2014, 01:22

... scored for the appearance of disease symptoms The infection status of the inoculated plants was assessed by visual inspection of symptoms and by PCR analysis of all plants at the end of the experiment ... (GCWGCAAAGACACCAAYGCCGT) were utilized to amplify a complementary and partially overlapped DNA -A segment Amplification of DNA-B sequences was performed with degenerated primers BC1-290 -for (GAARTAGTGGAGATCTATGTTR ... EditSeq (DNASTAR Inc., Madison, WI) Paired alignments were obtained by the ClustalV and ClustalW methods in the MegAlign application of the Lasergene package (DNASTAR), using the default parameters...

15
694
0

báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt

Ngày tải lên : 12/08/2014, 03:21

... TGTGACTTGTAACATTGCGCGGGTGCTTGGCACCATTTGCGTTACCTCAAA AAGCCTTTGAACACCCCAATTATTCATTTCTCGCGAAATCCAAAATTGCCT CGAAATGAACGTAAAGGCATCCACATATTTGTTCCAAGCCACATGACTCCT TTACATTGACCTCCTATGTCCCTAGGAGGCATCCCGTGCCATTTGGAGCTC GGGCAACGGGAAAGTCCGAAAGCGTGTATAATCTTCAATTTTAGTTGTTTT ... ACTGAAAAAAAATGAAGACTA 32 90 - 100 ED019743 BvMSat08 GAAAAAATAAGTTCAGATCAGATCAGATCA 32 48 77 - 100 DX107266 GGGTCGGAATAAATCGGCTTTCGAAATGACTT BvMSat09 32-39 24 46 - 100 FN424406 AGAAGTATACAAGAACATTAATCAAAATATATAAACAAA ... DX983375 CCTCTAAATGTAAGTGGCTTTAGCAGCACTATAAGTTCTGTGCCTAAAAAA FokI-satellite 130 60 81 - 100 DX979624 GGGACTTAGGAGAGTGACCCAACCAAGGAGGGAGACCTCCTTGGGCTGAGT GGTGGCATTACGGGCAACCAACAATTAGCGACAGGCATATGGTTG...

14
270
0

Báo cáo khoa học: "Quantitative physico-chemical analysis of the acidosis of cardiac arres" ppsx

Ngày tải lên : 12/08/2014, 22:22

... in equal amounts to that of lactate The presence of unmeasured ions alters the clinical interpretation and treatment of the patient This study has identified another area that needs further investigation ... Balasubramanyan N, Havens PL, Hoffman GM: Unmeasured anions identified by the Fencl–Stewart method predict mortality better than base excess, anion gap, and lactate in patients admitted in the ... 348 Makino J, Uchino S, Morimatsu H, Bellomo R: A quantitative analysis of the acidosis of cardiac arrest: a prospective observational study Crit Care 2005, 9:R357-R362 Prause G, Ratzenhofer-Comenda...

2
173
0

Báo cáo khoa học: "The epidemiology of severe sepsis in England, Wales and Northern Ireland, 1996 to 2004: secondary analysis of a high quality clinical" pps

Ngày tải lên : 12/08/2014, 23:22

... Mix Programme The Programme provides a national comparative audit of critical care for England, Wales and Northern Ireland and is co-ordinated by the Intensive Care National Audit & Research Centre ... however, most of these studies had a short time frame and were unable to describe changes over time We present data from an analysis of a database arising from a national audit of patient outcomes ... out of the critical care unit for ongoing care in another ICU or HDU, and the mortality at ultimate discharge from an acute hospital, both overall and by surgical status Activity was measured by...

10
340
0

Báo cáo y học: " Chemical fingerprinting and quantitative analysis of a Panax notoginseng preparation using HPLC-UV and HPLC-MS" pdf

Ngày tải lên : 13/08/2014, 14:20

... injection was produced by mixing sample solutions with the reference solutions at the ratio of 1:1 Data analysis Data analysis was carried out with Similarity Evaluation System for Chromatographic ... references; the rest 17 saponins were semiquantified with the substitutive standard references Additional material Additional file 1: The chromatogram of similarity analysis of the fingerprints of 10 samples ... potentially identified (Table 1) The ratio of total saponin peak area to all peaks (except for solvent peaks and baseline fluctuation in 0-28 min) in the chromatogram of each sample was beyond...

8
471
0

Báo cáo y học: " Treatment of candidemia and invasive candidiasis in the intensive care unit: post hoc analysis of a randomized, controlled trial comparing micafungin and liposomal amphotericin " pot

Ngày tải lên : 13/08/2014, 19:20

... Organism Candida albicans only versus non-albicans Candida C albicans, Candida tropicalis, Candida parapsilosis, Candida glabrata versus other Candida spp Candida parapsilosis versus other Candida spp ... other variables The APACHE II score was the only explanatory variable associated with treatment success, all-cause mortality at day 8, and all-cause mortality at day 30 These data underline the ... investigators in the clinical trial on which this post hoc analysis is based FS performed the statistical analysis All authors contributed to the design of the statistical analysis and reviewed and approved...

10
378
0

Báo cáo y học: "Dynamic simulation of red blood cell metabolism and its application to the analysis of a pathological condition" docx

Ngày tải lên : 13/08/2014, 22:22

... simulation for analyzing the pathology of human diseases should not approximate the "mathematical steady state" Moreover, in the case where the system reaches a steady state with a certain oscillation, ... simulated cell and the real cell regarding the timing of cell death could be caused by the lack of a pathway producing GSH This pathway may compensate for the decrease in GSH A mature RBC normally ... representing the normal state of the human RBC, they are not adequate for simulating irregular conditions such as deficiencies, because they lack alternative pathways that may normally not be particularly...

11
386
0

Báo cáo sinh học: "Molecular genetic analysis of a cattle population to reconstitute the extinct Algarvia breed" pptx

Ngày tải lên : 14/08/2014, 13:21

... group of 33 Algarvia animals and the Garvonesa breed through their sharing of haplotypes Common Iberian matrilines (European T3 and African T 1a) were found in the Algarvia population, as well as a ... study and designed and carried out the sampling procedure and selection of the putative Algarvia animals JM and CB contributed the genotype data for Algarvia, Garvonesa and Preta animals DN organised ... Mertolenga breeds (AG12 and AG17) For the Algarvia population, the average value of Q was 0.85 ± 0.27 and was the lowest among all breeds Results of GENECLASS assignments are summarized in Additional...

11
356
0