In vitro and in vivo evaluation of customized polycaprolactone tricalcium phosphate scaffolds for bone tissue engineering

... submitted for the degree of Master of Engineering in the Department of Mechanical Engineering at the National University of Singapore under the supervision of Professor Teoh Swee Hin and Dr Alvin Yeo ... secrete bone tissue and form the tissue around itself like a protective wall of bone tissue They are responsible for the maintenance of healthy bone by secreting enzymes and directing the bone mineral ... CHAPTER 4: OPTIMIZATION OF NATIVE AND CUSTOMIZED SCAFFOLDS IN VITRO AND THEIR EFFECTS IN INITIAL BONE HEALING 4.1 INTRODUCTION 44 4.1.1 In vitro degradation study 44 4.1.2 In vivo degradation study...

Improving the mechanical and functional performance of extrusion based additive manufactured scaffolds for bone tissue engineering

... IMPROVING THE MECHANICAL AND FUNCTIONAL PERFORMANCE OF EXTRUSION- BASED ADDITIVE MANUFACTURED SCAFFOLDS FOR BONE TISSUE ENGINEERING MUHAMMAD TARIK ARAFAT (B.Sc in Mechanical Engineering, ... mechanical and functional performance of extrusion- based additive manufactured scaffolds. ” The main objective of this study was therefore to develop additive manufactured scaffolds with improved mechanical ... Improvement of the functional performance of the additive manufactured scaffolds 140 8.1.4 Evaluation of the biomimetic composite coated additive manufactured scaffolds in vivo 8.2 Limitations and recommendations...

Báo cáo y học: "In vitro and in vivo evaluation of a new active heat moisture exchange" potx

... Performer and the Hygrobac had significantly higher airway temperature and AH than did the Hygroster (Fig 5) Active Performer, regardless of the level of heating, always had a higher temperature and AH ... inspiratory flow; VT = tidal volume Statistical analysis All data are expressed as mean ± standard deviation For the in vitro study, we compared the three HMEs using a one-way analysis of variance ... evaporation In the present study we assessed the efficiency and stability of this new active moisture exchanger in delivering heat and moisture to inspired gases, as compared with widely used heat and moisture...

In vitro and in vivo evaluation of transferrin conjugated lipid shell and polymer core nanoparticles for targeted delivery of docetaxel

... IN VITRO AND IN VIVO EVALUATION OF TRANSFERRIN- CONJUGATED LIPID SHELL AND POLYMER CORE NANOPARTICLES FOR TARGETED DELIVERY OF DOCETAXEL PHYO WAI MIN (M.B.,B.S (YGN) U.M(1)) ... the synthesis and characterization of transferrin conjugated lipid shell and polymer core nanoparticles are discussed in Chapter In Chapter 5, in vitro cellular study of transferrin conjugated LPNPs ... Organization In this thesis, formulations of lipid shell and polymer core nanoparticles are developed for the clinical administration of docetaxel At the same time, the effect of different lipids used in...

Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

... stability of PANs was studied in the aqueous medium, and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare ... main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically active drug that reaches the ... B A where AUC is the area under the curve Statistical analysis All data are presented as a mean value with its standard deviation indicated (mean ± SD) Statistical analysis was conducted using...

In vitro and ex vivo effect of hyaluronic acid on erythrocyte flow properties pps

... with variable HA concentrations, and reversibility of HA effect In vitro effect of several .hyaluronic acid (HA) concentrations on rigidity index (RI) Each sample was fractioned in aliquots (1 ml) ... interpretation of data of erythrocyte aggregation of the in vitro experiments GP: acquisition, analysis and interpretation of data of erythrocyte deformability of the in vitro experiments RV and SP: protocol ... Consequently, its increase may be explained by the rise in fibrinogen and/ or globulin concentration and/ or to the modification of the erythrocyte surface properties In our in vitro experiments, it...

In vitro and in vivo assessments of PCL TCP composites for bone tissue engineering

... bone tissue engineering for an ideal bone substitute 1.1.3 Strategies in BTE Tissue engineering is the restoration, improvement, maintenance and substitution of damaged tissues and organs using ... will be in solutions (Lakes, 2007) TCP is found naturally in the inorganic phase of bone in form of hydroxyapatite TCP is also responsible for the hardness of bone, dentine and enamel TCP exhibit ... 70-90% of minerals with the rest in the form of proteins Within the proteins in bone, the ratio of collagenous to noncollagenous stands at 9:1 This is in stark contrast with other tissues consisting...

In vitro and in vivo study of vitamin e TPGs coated immunoliposomes for sustained and targeted delivery of docetaxel

... the herceptin conjugated liposomes Thus the herceptin conjugated Vitamin E TPGS coated liposomes showed greater potential for sustained and targeted chemotherapy in the treatment of HER2 over expressing ... have been discovered and developed since the past few decades Together with the problems faced in traditional ways in which cancer patients are treated, this regimen has even become more and ... formulations were provided Then, Chapter presents the preparation and characterization vitamin E TPGS coated and herceptin conjugated liposomes The liposomes were prepared by solvent injection method and...

báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf

... stages and canal and reinserting the prosthesis The FRF had a normal evolution during the reinsertion and the graphs corresponding to the final two stages, labelled as stage 4a and stage 5a, are ... the FRF analysis showed an abnormality and the surgeon was alerted to the situation in time during insertion of the stem (Figures 7a c) The supplementary information obtained by vibration analysis ... 29:886-894 Jaecques S, Pastrav C, Zahariuc A, Perre G Van der: Analysis of the fixation quality of cementless hip prostheses using a vibrational technique In Proceedings of ISMA 2004 International Conference...

báo cáo hóa học:" An in vivo evaluation of bone response to three implant surfaces using a rabbit intramedullary rod model" doc

... and titanium-coated implants in rabbit bone Int J Oral Maxillofac Implants 1992, 7:485-490 35 Soballe K: Hydroxyapatite ceramic coating for bone implant fixation Mechanical and histological studies ... implant was press-fit into the intramedullary canal through a drill hole in the intercondylar notch of the femur Bilateral implantation was used to reduce any bias introduced by unilateral implantation ... Bone Joint Surg Am 2003, 85 -A: 885-889 49 Herrera A, Canales V, Anderson J, Garcia-Araujo C, Murcia-Mazon A, Tonino AJ: Seven to 10 years followup of an anatomic hip prosthesis: an international study...

Báo cáo y học: "In-vivo evaluation of simultaneous administration of incompatible drugs in a central venous catheter with a decreased port to port distance" pps

... suggesting particle size > µm in diameter At no point did any of the Research paper Evaluation of incompatible drugs in a venous catheter Reyes et al samples, control or study, fail to pass a µm aperture ... data are handled according to current College of American Pathologists’ standards Calibration of the analyzer is checked quarterly using a commercial calibrator Blinded specimens were examined ... respectively Discussion Central venous catheters in the pediatric population, and especially in the pediatric intensive care setting, are commonly used for the administration of intravenous fluids, drugs, ...

Báo cáo hóa học: " CdTe quantum dots with daunorubicin induce apoptosis of multidrug-resistant human hepatoma HepG2/ADM cells: in vitro and in vivo evaluation" pptx

... Access CdTe quantum dots with daunorubicin induce apoptosis of multidrug-resistant human hepatoma HepG2/ADM cells: in vitro and in vivo evaluation Gen Zhang1, Lixin Shi2, Matthias Selke2 and Xuemei ... Cite this article as: Zhang et al.: CdTe quantum dots with daunorubicin induce apoptosis of multidrug-resistant human hepatoma HepG2/ADM cells: in vitro and in vivo evaluation Nanoscale Research ... evidence of apoptosis of HepG2/ADM cells in vitro It is possible that Cdte QDs + DNR could play a critical role in inducing apoptosis in vivo The tumor growth in group nude mice (treated with Cdte...

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

... ampliﬁcation with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag ... template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ ... shielded from trypsin digestion on the cis-side of the membrane The A B 4004 Fig Determination of the topology of PSI -G in the thylakoid membrane using in vitro import experiments (A) Insertion...

Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc

... and cellular responses; and analysis of T-cell proliferation LG contributed to CIA induction and evaluation and to analysis of T-cell proliferation PM contributed to the design of the study and ... inhibition of T-cell proliferation was demonstrated by the addition of inhibitors of these enzymes - GW274150 and indomethacin [8,36], respectively - to the co-cultures The addition of these inhibitors ... Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis Arthritis Research & Therapy 2010 12:R31 Submit your next manuscript...

Báo cáo khoa học: "Comparative study on the in vitro and in vivo properties of two bovine herpesvirus-5 reference strains" pptx

... point, a direct comparison of the pathogenecity of these strains is difficult to make In this context, the aim of the present study is to compare the in vitro and in vivo properties of these two ... to the sensitivity of the ELISA test available In the case of animal 191, as discussed above, the reason could have been the lack of infection Page of Conclusions The in vitro and in vivo properties ... Comparative study on the in vitro and in vivo properties of two bovine herpesvirus-5 reference strains Acta Veterinaria Scandinavica 2011 53:37 Submit your next manuscript to BioMed Central and take...

Xem thêm

Từ khóa: in vivo evaluation of oral dosage form performance in vivo evaluation of putative hematopoietic stem cells derived from human pluripotent stem cells in vivo evaluation of gene transfer into mesenchymal cells in view of cartilage repair fiber bonding and particle aggregation as promising methodologies for the fabrication of biodegradable scaffolds for hard tissue engineering bioactive composite materials for bone tissue engineering scaffolds sophie verrier and aldo r boccaccini development of a scaffold for bone tissue engineering confocal microscopy of skin in vitro and ex vivo research studies of qigong therapy for cancer for the past 20 years in china were reviewed from three different categories clinical study on human cancer patients in vitro study of cancer cells and in vivo study of cancer with qigong therap in vitro and in vivo analysis of the cell in vitro and in vivo degradation of phytate apos apos 8p specific apos apos microarrays two novel metastatic suppressors were identified and proved to suppress in vitro invasion and in vivo metastasis of hcc in vitro and in vivo evaluation nanobiosensors for in vitro and in vivo analysis of biomolecules vitro ex vivo and in vivo roles of mscs in vitro in vivo correlation of the causal relationship between cigarette smok ing and higher incidence of carcinomas Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ