0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Impacts of a firms technological diversification on product diversification and performance

Impacts of a firms technological diversification on product diversification and performance

Impacts of a firms technological diversification on product diversification and performance

... impact of technological and product diversification affect firm financial performance? Management of technological diversification is as complex as that of product diversification so that overdiversification ... Holtz-Eakin et al (1988) and Arellano and Bond (1991) to test the dynamic and bidirectional relationship between technological and product diversification I found that technological diversification ... bidirectional relationship between technological diversification and product diversification, I have found that technological diversification exhibits an inverted U-shaped relationship on product diversification...
  • 85
  • 270
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article The Effect of a Voice Activity Detector on the Speech Enhancement Performance of the Binaural Multichannel Wiener Filter" ppt

... with attack and release time constants τraise and τdecay The differences between the maxima and minima are calculated to obtain the current dynamic range of the signal (4) The decision for a speech ... vectors containing speech samples will be added to the noise data matrix in (5), which leads to cancellation of parts of the speech signal On the other hand, if too many actual noise samples are detected ... stationary directional noise and nonstationary diffuse noise The nonstationary noise is derived from recordings in a restaurant to approach a real world situation Section provides a discussion of...
  • 12
  • 505
  • 0
The impact of a genre-based approach on 11th students’ writing performance An action research at Tuyen Quang Gifted High School, Tuyen Quang

The impact of a genre-based approach on 11th students’ writing performance An action research at Tuyen Quang Gifted High School, Tuyen Quang

... performance The research focused only on the students‘ difficulties in learning the writing skill and the impact of genre-based approach to their writing performance at Tuyen Quang Gifted High School, Tuyen ... This research method was aimed at providing information on students‘ attitudes towards, and opinions about, the genre-based approach that their teacher (also the researcher) used In addition to the ... Tuyen Quang, Vietnam The research lasted for weeks and the treatment was applied to all students in a classroom The research mainly focused on 11th form students majored in Mathematics The research...
  • 5
  • 548
  • 6
Báo cáo sinh học:

Báo cáo sinh học: " Impacts of both reference population size and inclusion of a residual polygenic effect on the accuracy of genomic prediction" potx

... proportion of additive Results and discussion Genomic validation using German national data Table shows the results of genomic validation based on the national genomic and phenotypic data of German ... Cite this article as: Liu et al.: Impacts of both reference population size and inclusion of a residual polygenic effect on the accuracy of genomic prediction Genetics Selection Evolution 2011 ... investigate (1) the impact of the size of a genomic reference population using German reference bulls on the estimation of SNP effects and on direct genomic values (DGV) and (2) the impact of including...
  • 9
  • 524
  • 0
Báo cáo y học:

Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"

... precision of therapy like the intensity-modulated radiation therapy (IMRT) and the use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain ... 14 It was used to investigate whether an intracellular MR imaging is possible and to estimate the T1 relaxivity on MR (1.5 T) Historically already in 1994 electron-spin-resonance and mass-spectrometry ... Okumura M, Mikawa M, Yokawa T, et al Evaluation of water-soluble metallofullerenes as MRI contrast agents Acad Radiol 2002; (Suppl 2): S495-S497 Tang J, Xing G, Zhao F, et al Modulation of structural...
  • 11
  • 655
  • 0
Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi- state system theory According to (2), the universal generating function of the battery ... this paper, and is compared 97 (1) The reliability of the power system obtained by the traditional system reliability theory is always conservative [5] (2) The power system is a multi- state system ... reliability theory are always conservative For example, when the required capacity is 23.4 Ah, the reliability of the system obtained by the traditional system reliability theory is only 0.25107, but the...
  • 4
  • 407
  • 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... W, Thanki N, Jaenicke R & Wierenga RK (1997) A double mutation at the tip of the dimer interface loop of triosephosphate isomerase generates active Effect of mutation on the dimer interface of...
  • 15
  • 635
  • 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its target sequence To this a DNA alkylating ... molecular mass markers be further accumulated within the mitochondria due to the mitochondrial membrane potential [11] From the known plasma and mitochondrial membrane potentials and the cell and mitochondrial...
  • 10
  • 638
  • 0
The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx

The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx

... The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance Robert G Eccles, Ioannis Ioannou, and George Serafeim Abstract We investigate the effect of a corporate ... Supplier Standards Product LCA Human Rights Standards International Standards Compliance National Standards Compliance EMS Environmental Data Availability Environmental Policy Grievance Process Labor ... Firms: A Model of Myopic Corporate Behavior Quarterly Journal of Economics 104: 655-669 Ullmann, A A 1985 Data in search of a theory: a critical examination of the relationships among social performance, ...
  • 57
  • 447
  • 0
Evaluating impacts of air pollution in China on public health: Implications for future air pollution and energy policies pptx

Evaluating impacts of air pollution in China on public health: Implications for future air pollution and energy policies pptx

... Protection Agency Of ce of Air and Radiation Policy Feng, T., 1999 Controlling Air Pollution in China: Risk Valuation and the Definition of Environmental Policy New Horizon in Environmental Economics ... air pollution control options but is lacking in China s current policy decision making Our objective is to establish such a link by quantifying the impacts of air pollution in eastern China on public ... CO2-emission reduction measures in Shanxi, China their importance in context of CDM, Policy reform and the environment in China, organized by PACE (Profeesional Association for China s Environment),...
  • 16
  • 663
  • 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx

Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx

... Tsugita & Scheffler [23], and amino-acid analysis was carried out on a Hitachi-835 analyzer (Tokyo, Japan) in the standard mode for protein hydrolysate analysis with cation-exchange separation and ... complex band of valent water OH-bond vibrations is overlapped with peaks of valent OH-bond and NH-bond vibrations of PVX CP Thus, to estimate the state of water molecules in the virus preparations, ... the virion itself are affected by changes in the state of the virion water shell and this state may be altered by changes in glycosylation, phosphorylation and other types of modification of the...
  • 10
  • 398
  • 0
Title: A History of Art for BHistoric Doubts on the Life and Reign of King Richard the Thirdeginners and Students: Painting, Sculpture, Architecture Painting docx

Title: A History of Art for BHistoric Doubts on the Life and Reign of King Richard the Thirdeginners and Students: Painting, Sculpture, Architecture Painting docx

... that Richard made his son Richard of Gloucester, captain of Calais; but it appears from Rymer's Foedera, that Richard' s natural son, who was captain of Calais, was called John None of these accounts ... in a situation of personally knowing the transactions of the times; for in one place we are told in a marginal note, that the doctor of the canon law, and one of the king' s councellors, who was ... the crown after Richard the Second Richard duke of York, the father of Edward the Fourth and Richard the Third, was son of Richard earl of Cambridge, beheaded for treason; yet that duke of York...
  • 50
  • 543
  • 0

Xem thêm

Từ khóa: what does the vapor pressure of a pure liquid depend onthe vapor pressure of a given liquid depends onvapor pressure of a pure liquid depends onrobust nonlinear control of a hypersonic aircraft based on sliding mode controlthe vapor pressure of a pure liquid depends on which of the followingthe vapor pressure of a pure liquid depends oninfluence of ligand properties on product structure and reactivityarchitecture apos s loss of a distinct technological voicesick product syndrome sps a new ergonomic approach on product designsimple characterization of a magnetic adsorbent apos s product binding behaviormeasures the affect of a exchange rate change on published financial statemment of a firmthe method called getarea returns the area of a circle object based on its radius propertyc impact of a change in exports on wage growthproceedings of the sixth international symposium on micro machine and human sciencea cross culrual study on giving compliment and responses in english and vietnameseNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015