... O2affinity, K , can be derived for both the a and b subunits from the averaged parameters of HbA oxygenation (Table 1, Average). The associationand dissociation rate constants for the b subunitsare found ... afterphotodissociation, d, is calculated as the ratio of the quantum yield of BR, c, to that ofthe primary quan-tum yield of photodissociation, c0.Having the individual parameters of bimolecularoxygenation ... NaCl.Fig. 4. The parameters of O2binding to thea and b subunits within liganded hemoglobin as a function of NaCl concentration. Bars 1, 2 and3 are the relative changes in the association (kÂ),...
... 22.8ssRG=≥}Equation (1) indicates that when the capacity ofthe system is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh. Suppose the capacity ofthe first ... reliability theory defines the power system and the batteries are binary, but they are all multi-state actually. The performance ofthe batteries can degrade, which results in performance degradation ... G is the capacity ofthe battery. 2150()2~ 6000,150GNTo analyze the reliability ofthe system by the traditional system reliability theory, we must gain the reliability ofthe battery...
... Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* ... calibration standards provided by the manu-facturer. Data processing was performed using the deconvo-lution module ofthe data analysis software to detect the multiple charge states and obtain ... maintaining the geometry of the active site. The availability of crystal structures of TIMs from 21 sources and the large database of TIMsequences from various sources facilitate an analysis of mutational...
... roughcomparison ofthe dissociation velocities indicated atleast a 10-fold faster liberation ofthe fluorescent ana-logue when compared with Cbl. The CBC dissociationspanned at least 90% ofthe total ... °C was incubated over time. Free ligandswere adsorbed on charcoal, and the absorbance spectrawere recorded. Concentration of appearing IF–CNCbl wascalculated by comparison with the standards ... respects. An alternativeexplanation seems to be more probable. Thus, distor-ted shape ofthe analogue causes partial corruption of its bonds with IF. As a consequence, the ligand and the protein...
... TCA TCATCA TCA TCA GGG CAC GAC ACA CAT CCC C; andreverse primer, GAT CGG TAC CTC ATT ACA GAGGAG GGA TAT GGG GAA C. The PCR reaction wasdone as described above. The amplified PCR product wasinserted ... was amplified from genomic T. reesei DNAwith thefollowing primers: forward, GGG GAC AAGTTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGTCAG GTC CCT CTC G; and reverse, GGG GAC CACTTT GTA CAA GAA ... ⁄ TOF fragment ion analysis as well asby Edman degradation ofthe corresponding peptideafter purification by reversed-phase chromatography.During the search for and confirmation ofthe N-ter-minus...
... purification.Erythrocyte preparationBlood for HA assay was prepared as described byRavindranath et al. [12].Hemagglutination assayHemagglutination assays were performed in microtiterplates (Falcon) as recommended ... of animal glycoconjugate. They actas an important component ofthe ligands recognized by the lectins. Recognition can be affected by specific structuralvariations and modifications of sialic acids ... sialicacid may change with transformation or other alteration in the environment ofthe cell [63]. The normal human tissuescontain NeuAc, while malignant tumour cells containO-acetyl sialic acid...
... extra-peroxisomal Aco1p.As mentioned previously, malate synthase catalyses the formation of malate from glyoxylate and acetyl-CoA, the source ofthe latter being either peroxisomal when breakingdown ... (Fig. 4A) .To examine whether a cytosolic malate synthase was asefđcient as a peroxisomal one for m aintaining a functionalglyoxylate cycle on oleic acid, liquid growth assays wereconducted. The ... cytosolicsupernatant. Equal fractions of each ofthe protein prepa-rations (10% of total vol) were i mmobilized on replicatemembranes to which were applied antibodies against Mls1por yeast peroxisomal...
... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1). The mutantG26 1A/ Y26 9A exhibits an E a almost the same as in the caseofthenativeenzyme(Table1).Thermal inactivation ... andoverexpression ofthe gene encoding alkaline phosphatasefrom the Antarctic strain TAB5 [16]. Based onthe crystalstructure (at 2.4 A ˚)ofanEscherichia coli alkaline phospha-tase variant ... with the aromatic ring of Tyr269, and theseunfavorable interactions could lead to a decrease of localflexibility and an increased E a value. The validity ofthe above interpretation was furtherreinforced...
... DR2:5Â-CCGTAAGGTCACAAGGTCACTCG-3Â,DR3:5Â-CCGTAAGGTCACAGAGGTCACTCG-3Â, DR4: 5Â-CCGTAAGGTCACAGGAGGTCACTCG-3Â, DR5: 5Â-CCGTAAGGTCACCAGGAGGTCACTCG-3Â. PAL0: 5Â-CGCAAGGTCATGACCTCG-3Â. One strand of each oligonucleotide wasannealed after ... [21]. A SmNR1 specific probe of 497 bp wasproduced by PCR amplification with TOPO 2.1-SmNR1 as a template (forward primer: 5Â-ATTTCAGAAGTTGAACAAACACAC-3Â, reverse primer: 5Â-AAGATGGTATTGAAGATGATGGTTGA-3Â), ... gene in mammalian cells suggests thatSmNR1 ⁄ SmRXR1 can interact with mammalian coac-tivators of transcription, and S. mansoni coactivators of transcription may have a similar mechanism toSmNR1...
... toproduce acyl-CoA onthe outer membrane of mitochondria.Acyl-CoA is then transported into the matrix forb-oxidation of acyl-group. Among the MACS familyproteins with the acyl-CoA synthetase activity, ... (5Â-GAATTCatgaaggttctcctccactg-3Â)and rO-MACS-XhoI-D (5Â-CTCGAGtgcccgtccccactcctggt-3Â)for o-macs; EcoRI-mMACS1-U (5Â-GAATTCatgcagtggctgaagagttt-3Â) and mMACS1-XbaI-D (5Â-TCTAGAtagctgaccaaactccttg-3Â)forMACS1, ... Yoshihara, Y., Kawasaki, M., Tamada, A. , Fujita, H., Hayashi,H., Kagamiyama, H. & Mori, K. (1997) OCAM: a new member of the neural cell adhesion molecule family related to zone-to-zoneprojection...
... than the susceptibleweevil strains. Surprisingly, the microsomal fraction of anextract ofthe resistant insect D. melanogaster also displayed a strong binding capacity. The determination ofthe ... increasingconcentrations of 125I-labelled PA1b (0.35–3.2 nM).Table 2. Effect of proteinase K on the 125I-labelled PA1b bindingactivity onthe microsomal fraction of S. oryzae WAA42 extract.Treatment a Binding ... post-translational cleavage of the albumin proprotein PA1, also releasing a second peptide(PA 1a) . PA1b consists of 37 amino acids, with six cysteinesinvolved in three disulfide bonds which confer the...
... correspondingdissociation constants. In this equation, it was easier for a calculated constant to compare its value relative to zerorather than to obtain a large value. When the associationconstant value was ... discrepancy was explained by the higher affinity of acarbose for PPA as indicated by the lower dissociationconstant ofthe acarbose-PPA complex (1.7 lM)[24] .The dissociation constant ofthe acarbose-AMY ... lMdecreasing to 37.3 lMby addition of acar-bose. A 0is the AMY1 absorbance without acarbose, A is the absorbance measured at the above acarbose concentrations.(B) Reciprocal plot ofthe difference...