Construction of bacterial artificial chromosome library for kineosphaera limosa strain lpha5t and screening of genes involved in polyhydroxyalkanoate synthesis

... CONSTRUCTION OF BACTERIAL ARTIFICAL CHROMOSOME LIBRARY FOR Kineosphaera limosa STRAIN Lpha5T AND SCREENING OF GENES INVOLVED IN POLYHYDROXYALKANOATE SYNTHESIS JI ZHIJUAN ... (BAC) library of Kineosphaera limosa strain Lpha5T was constructed in vector pBeloBAC11 Lpha5T BAC library contains 7680 BAC clones with an average insert of 23.5 kb BAC library of Kineosphaera limosa ... isolate and further investigate the genes involved in the metabolisms of PHA in EBPR systems The bacterial isolate was Kineosphaera limosa strain Lpha5T isolated from an inefficient EBPR reactor Lpha5T...

báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf

... and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, TTCCAAGTTCTTGTGGGAGGAG, GACTGATTTTCTCTCCACCAAGCAAG) Sequence analysis Repetitive DNA was identified with the RepeatMasker software ... on the BAC scaffolds of PGB02 (3CAR) (ACCCATCTTCACAAAATTAC, GTAGTCCATAACGAGCAGAA) and PGB04 (CYP720B4) (TGATATTTGGTCTGCCATGGGCG, CATTTCCCTGCATGTATTCAATGCC, CCACCACATAGTTAGACCGTGATGC) Authors' ... contain a TCA-element at positions -815 and -3,291 in PGB02 and at positions 1,227, -676 and -1,162 (TCAGAAGAGG, GAGAAGAATA and CAGAAAAGGA) in PGB04, respectively This element was first characterised...

Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"

... ethanol- regulated genes were involved using KEGG (Kyoto Encyclopedia of Genes and Genomes) [36] and GenMAPP (Gene Microarray Pathway Profiler) [37] analysis As shown in Table 2, only ITGB4 was found to be involved ... considering the reported high expression of the ankyrin-repeat oncoprotein (gankyrin) in human hepatocellular carcinoma Gankyrin binds to the cell-cycle regulator CDK4 and the S6b ATPase subunit of ... chemokines in monocytes and macrophages (including Kupffer cells) [41, 42], and ethanol- induced mucosal injury in the upper gastrointestinal tract leading to increase in the permeability of the gut...

Tài liệu Báo cáo Y học: Identiﬁcation of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

... identiﬁcation and quantiﬁcation of puromycin were achieved by a Pac enzymatic assay [21] Preparation of 3¢-amino-3¢-deoxyadenosine 3¢-amino-3¢-deoxyadenosine was obtained from Helminthosporium sp ATCC20154 ... Schematic representation of the putative biosynthetic pathway of the 3¢-amino-3¢deoxyadenosine moiety of A2 0 1A and puromycin Dpur4 mutants The results indicated that this mutation was clearly complemented ... erythraea, the erythromycin-producing organism, has permitted the isolation of Streptomyces antibioticus genes implicated in oleandomycin biosynthesis [40] Gene analyses and enzymatic assays suggest...

Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several speciﬁc biological processes through GCN2-dependent and GCN2-independent pathways ppt

... devoid of a given essential amino acid Our data suggest that the GCN2 pathway is directly involved in the regulation of amino acid and protein metabolism, as many of the genes involved in these processes ... their biological processes reveals that amino acid limitation regulates groups of genes that are involved in amino acid and protein metabolism, lipid and carbohydrate metabolism and various processes ... by amino acid starvation Further investigations are necessary to determine the relevance of the amino acid regulation of the genes involved in carbohydrate and lipid metabolism In particular, the...

Báo cáo y học: " Transcriptome profiling of primary murine monocytes, lung macrophages and lung dendritic cells reveals a distinct expression of genes involved in cell trafficking" pot

... investigating the relation, differentiation and/ or maturation of monocytes, macrophages and DC have been mainly conducted in vitro using both murine and human cells [33-35] A study comparing primary ... purity of sorted cells used for the microarray experiments (PBMo, lung DC and lung Mϕ) was assessed by flow cytometry and Pappenheim-stained cytospins and was always ≥ 98% As sample processing may ... Validation of chemokine and interleukin genes byqRT-PCR Validation of chemokine and interleukin genes byqRT-PCR PBMo, lung Mϕ and DC were sorted as shown in Fig 1A and 2A mRNA expression was assessed...

the regulation of genes involved in trichome development

... redundant inhibitors of trichome initiation The key to understanding the process by which a cell adopts the trichome fate lies not only in finding the components of the initiation and inhibitory ... preferentially with the bHLH dimer, preventing expression of genes involved in trichome development TTG would act in the cytoplasm most probably aiding in the association of the bHLH dimer 13 enters the nucleus ... changes One of the most interesting of these changes has to with the regulation of the cell cycle Early in their development trichomes replicate their chromosomes several times without undergoing mitosis...

the regulation of genes involved in trichome development(fileminimizer)

... redundant inhibitors of trichome initiation The key to understanding the process by which a cell adopts the trichome fate lies not only in finding the components of the initiation and inhibitory ... preferentially with the bHLH dimer, preventing expression of genes involved in trichome development TTG would act in the cytoplasm most probably aiding in the association of the bHLH dimer 13 enters the nucleus ... interactions between proteins involved in trichome patterning A combination of a MYB protein (either GL1 or MYB23) with a bHLH dimer (any combination of GL3 or EGL3) produces the trichome initiation complex...

Effects of high glucose concentrations on the expression of genes involved in proliferation and cell fate specification of mouse embryonic neural stem cells

... EFFECTS OF HIGH GLUCOSE CONCENTRATIONS ON THE EXPRESSION OF GENES INVOLVED IN PROLIFERATION AND CELL- FATE SPECIFICATION OF MOUSE EMBRYONIC NEURAL STEM CELLS FU JIANG (MD, MMed) A THESIS ... Illustration Schematic summary of the effects of high glucose on the expression of developmental control genes that are involved in proliferation, survival and differentiation of neural stem cells ... promote the differentiation of autonomic neurons and induce the expression of Ascl1 indicating that BMP2 and BMP4 control the specification of autonomic neurons through the induction of Ascl1 expression...

báo cáo khoa học: "Prospecting for Genes involved in transcriptional regulation of plant defenses, a bioinformatics approach" pdf

... resistance regulator The Plant Journal 2009, 58:578-591 Yasuda M, Ishikawa A, Jikumaru Y, Seki M, Umezawa T, Asami T, MaruyamaNakashita A, Kudo T, Shinozaki K, Yoshida S, Nakashita H: Antagonistic ... micro-arrays in the dataset The work was performed without external funding Microarray Dataset The dataset of 1436 Affymetrix Arabidopsis 25K arrays obtained from NASCArrays and AtGenExpress was ... of the available online tools Within the plant field there is an increasing number of publications that report the finding of biologically relevant genes involved in certain pathways via coexpression...

Báo cáo y học: "Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma" docx

... regulatory modules including TBPF (TATA -binding protein factors) , ECAT (enhancer of CCAAT binding factors) , or PCAT (promoter of CCAAT binding factors) p53 binding motifs were also displayed '(+)' and ... genotype and protein expression in UM-SCC cell lines p53 genotype and protein expression in UM-SCC cell lines (a) The p53 genotype of ten University of Michigan series head and neck squamous cell ... p53-NFYC (nuclear factor YC) and p53-YB-1 (Ybox -binding protein 1) were observed, and NFYC and YB-1 belong to ECAT and PCAT families It has been shown that YB-1 (also known as DNA binding protein...

Formulate busines strategy for Dinh Vu port development and investment joint stock company in period of 2013-2018

...

Construction of business strategy in period of 2010 - 2015 of Song Da someco joint stock company

...

Higher education and the construction of institutional identities in a globalising world

... Kong and Singapore, and finally taking hold powerfully in mainland China and India – has altered the balance of power in the global economy and hence in geopolitics The rising nations of the East ... between a global brand like Coca Cola and Levi’s and being ‘global’ as a brand In both instances, these arise out of the processes of globalization In the case of global brands such as Coca Cola, there ... a transformation in the spatial organization of social relations and transactions generating transcontinental or interregional flows and networks of activity, interaction, and the exercise of...

Báo cáo khoa học: Therapeutic targeting of molecules involved in leukocyte–endothelial cell interactions potx

... transcriptional induction and redistribution from intracellular pools [20] Integrins mediate cell cell, cell extracellular matrix and cell pathogen interactions by binding to distinct, but overlapping, ... al Targeting leukocyte–endothelial cell interactions Fig Cell surface molecules as potential targets in inﬂammatory bowel disease as a lymphocyte-driven disease Selectins Selectins consist of ... al Targeting leukocyte–endothelial cell interactions Fig Cell surface molecules as potential targets in systemic in ammatory response syndrome as a neutrophil-driven disease Table Targeting cell...

Xem thêm