A sketch based system for infra structure presentation
A sketch based system for infra structure presentation
... understand that gesture operations are not omnipotent, and have limitations [3] We are to solve the infra- structure presentation problem with a sketch- based interface, which is a manual way Efforts ... generate precise 3D models and support high level editing Compared to industrial CAD packages, sketch based interfaces fast conceptualize ideas and communicate information, but have disadvantages ... extent e and control parameter c, there are other skeleton state parameters All state parameters, and their relation with deformation operations are listed in Table 4.1 CHAPTER SKELETON BASED MODEL...
- 73
- 267
- 0
A web-based system for notifying environment violation.doc
... Geographic Information system (GIS) is any system integrates hardware, software, and data for capturing, managing, analyzing, and displaying all forms of geographically referenced information ... operating system - Easy to manage, update database: Database is located at dedicated server that managers can maintain and update it easily - Quick delivery: web-based model make it portable to ... 2.3.2.3 Data access tier It consists of the database server that contains all logic data of application Separating logic data from application into it will make program scalable and higher performance...
- 56
- 410
- 0
Sprite: A Simple, Cheat-Proof, Credit-Based System for Mobile Ad-Hoc Networks potx
... [Online] Available: http://gunpowder.stanford.edu/˜laik/projects/adhoc/mitigating.pdf [5] L Buttyan and J P Hubaux, “Enforcing service availability in mobile ad-hoc WANs,” in IEEE/ACM Workshop on Mobile ... unicast case As route-discovery broadcast can be viewed as a special case of multicast, this approach can also be applied to multicast if multicast is not frequently used in the system If multicast ... intermediate node to forward a message, respectively We observe that RSA has a much smaller forwarding overhead Thus, if reducing forwarding overhead is the major objective, RSA is a better implementation...
- 11
- 916
- 0
A Fast File System for UNIX
... the additions and changes that have been made to the facilities that are available to programmers The original UNIX system that runs on the PDP-11† has simple and elegant file system facilities File ... block is allocated and the * A program may be overwriting data in the middle of an existing file in which case space would already have been allocated SMM:05-6 A Fast File System for UNIX first ... throughput rates are already limited by the speed of the available processors A Fast File System for UNIX SMM:05-11 File system functional enhancements The performance enhancements to the UNIX file system...
- 14
- 1,023
- 0
A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA
... identifying the areas that discharge high pollutant loading into receiving waters METHODS Our area of interest was Marina del Rey and its vicinity in the Santa Monica Bay Watershed Santa Monica Bay ... loading areas, which were classified as public land use in the SCAG data and USGS classification system Recreational facilities including parks were also classified as low pollutant loading areas, ... area From these results, the new classification system for managing stormwater pollutant loads was developed as shown in Table Table New classification system for stormwater pollutant mass emissions...
- 7
- 575
- 0
A dynamic programming algorithm for RNA structure
... calculate the gap matrices For a given gap matrix, we have to consider all the different ways that its diagram can be assembled using one or two matrices at a time (Again, Feynman diagrams are ... folding and for RNA structural alignment and structural similarity searches The Inside and CYK dynamic programming algorithms used for SCFGbased structural alignment are fundamentally similar to ... (although admittedly high) Having an optimal dynamic programming algorithm will enable extending other dynamic programming based methods that rigorously explore the conformational space for RNA...
- 16
- 688
- 0
Tài liệu A Knowledge Management System for ERP Implementation pdf
... stage To accomplish this, Table summarizes the KM practices in ERP implementation process A KNOWLEDGE MANAGEMENT SYSTEM FOR ERP IMPLEMENTATION Knowledge management systems (KMS) refer to a class ... The ERP change in China: a resourcebase perspective Information Systems Journal 14: 153– 167 Jarrar Y 2002 Knowledge management: learning for organizational experience Managerial Auditing Journal ... growing rapidly AMR Research, an authoritative market forecast institution in America, indicated that the ERP market would grow at annual rate of 37% in recent years The sales of the ERP packaged...
- 12
- 622
- 1
Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc
... Systems, ed P Jacobs, Lawrence Erlbaum Associates, Hillsdale, NJ, pp 13-33 Kameyama, M (1992) "The Syntax and Semantics of the Japanese Language Engine", forthcoming In Mazuka, R., and N Nagai, ... is that when they are formulated loosely, as in the previous paragraph, they appear to conflict In particular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a modifier ... Data Collection for a Spoken Language Corpus", in Proceedings of the DARPA Speech and Natural Language Workshop, February 23-26, 1992 Marcus, M (1980) A Theory of Syntactic Recognition for Natural...
- 8
- 376
- 0
Tài liệu Báo cáo khoa học: "A UNIFICATION-BASED PARSER FOR RELATIONAL GRAMMAR" doc
... an operator, &, unique to SFG Formulas involving ~ are called e~tension formulas and they have a more complicated semantics For example, Dative has the following informal interpretation: Two distinct ... empty For c = , , k , for each Graph(hi) of Wc, add [ni, c - 1, c] to Se B Completions: For c = , , k, repeatedly until no more states can be added to Se: L e f t w a r d Completion: For ... with another arc To sum up: We have developed a unificationbased, chart parser for relational grammars based on the SFG formalism presented by Johnson and Moss [2] The system involves compiling...
- 8
- 383
- 0
Báo cáo khoa học: "A Cloud-Based Platform for Do-It-Yourself Machine Translation" potx
... LetsMT! platform is heterogeneous The majority of services run on Linux platforms (Moses, RR, data processing tools, etc.) The Web server and application logic services run on a Microsoft Windows platform ... services run on a Microsoft Windows platform The system hardware architecture is designed to be highly scalable The LetsMT! platform contains several machines with both continuous and ondemand ... per hour For this use case, LetsMT! has creation of appropriate data resources as painless developed plug-ins for integration into CAT tools as possible Therefore, we included support for the...
- 6
- 396
- 0
Báo cáo khoa học: "A Transition-Based Parser for 2-Planar Dependency Structures" pot
... correct for 2-planar dependency forests, neither of which existed in the literature before In addition, we have presented empirical results showing that the class of 2-planar dependency forests ... the parser will build a 2-planar dependency forest by using each of the stacks to construct one of its two planes The 2-planar transition system, shown in Figure 4, has configurations of the form ... constraints, guarantees that the dependency graphs associated with reachable configurations are always 2-planar dependency forests For completeness, we assume an extended form of the transition system...
- 10
- 281
- 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
- 9
- 444
- 0
Báo cáo khoa học: "A NLG-based Application for Walking Directions" doc
... information provided by these resources, examine the respective input and output formats, and state how the formats are integrated into a common data representation in order to access the information ... semantic representations The application is planned to be used in web experiments to acquire further data for alignment and to study specific effects in the generation of walking instructions in a ... and reasonable generalizations in data modelling will likely yield enough information for the intended navigation applications coordinate (using the LocalSearch method in Google AJAX Search and...
- 4
- 234
- 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx
... Ishihara et al (Eur J Biochem 270) Here we examined the effects of SA on stress response in mammalian cells using a simple screening system, and revealed that SA is a potent Hsp inducer in mammalian ... expression of endogenous heat shock proteins such as Hsp1 0 5a and Hsp7 0 in various mammalian cells Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells ... neurodegenerative disorders including Alzheimer’s, polyglutamine and Parkinson’s disease are though to be caused by an accumulation of protein aggregates in the brain [24], and Hsps such as Hsp7 0 and Hsp4 0...
- 8
- 470
- 0
Pastured Poultry Raising Chickens in a Grass-Based System docx
... http://www.motherearthnews.com/Real-Food/2007-1001/Tests-Reveal-Healthier-Eggs.aspx#ixzz27LvkfgLn Other Benefits of Pastured Poultry • Ethical concerns • Appealing appearance of flock to customers You’re not just marketing a product, you are marketing a way of life! Pastured ... advanced feathering – use feathering as a guide for decreasing temperature as the amount of feathering a chick has will dictate its cold-tolerance Look for signs of stress in the chicks to make ... What is Pastured Poultry? Pastured poultry ≠ free range! • “free range” is a marketing term • “Producers must demonstrate to the Agency that the poultry has been allowed access to the...
- 64
- 272
- 0
Từ khóa: topicspam a topicmodel based approach for spam detectiona multidocument summarization system for scientific articleshow to make a reverse osmosis system for maple syruphow to build a reverse osmosis system for saphow to build a reverse osmosis system for maple sapglobal system for mobile communicationpowerpoint presentationgemini a natural language system for spokenlanguage understandinga natural language system for spoken language applicationsdesign of a knowledge based system6 implement a safety management system for faadevelopment of a digital imaging system for objective measurement of hyperpigmented spots on the facea haplotype analysis system for genes discovery of common diseasesa prehospital database system for emergency medical servicesa web information system for microarray experimentsa quality control system for carmodelNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ