a prehospital database system for emergency medical services
An Object-Oriented Multimedia Database System for a News-on-Demand Application* pot
Ngày tải lên :
30/03/2014, 22:20
... relational database This model forms a basis for a hierarchical data model and for temporal access control algorithms to allow VCR-like capabilities They show how it can be mapped to a relational ... media, and (Gibbs et al 1993) deals with so-called audio/video (AV) databases These databases are collections of digital audio/video data and processes which can 37 compose and aggregate these data ... object-oriented database in later stages of this research This will enable us to take advantage of advanced features like temporal models that are fundamental for multimedia applications It is hoped that...
- 45
- 252
- 0
Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx
Ngày tải lên :
20/06/2014, 00:20
... years of practical experience and the limited time allowed for occupational medical examinations speak for a systematic subdivision of the physical examination into a screening phase and, based on ... into account the fact that occupational medical prophylaxis does not aim primarily at producing a therapeutic indication but at prevention From the large number of available validated tests for ... for orthopaedic and manual diagnostics, here for reasons of efficiency and usability of the system in routine occupational medical examinations, the measures are chosen according to the situation...
- 10
- 575
- 0
IC implementation of a bioelectric acquisition system for medical application
Ngày tải lên :
22/10/2015, 21:19
... methods that are both fast and accurate in diagnosing a patient, a particular challenge has arisen in noninvasive medical diagnostic procedures Because biosignals recorded on the body surface reflect ... approximation analog-to-digital converter (SAR ADC) was implemented A capacitive DAC was use to eliminate the need of a sample and hold circuit By using a novel yet simple algorithm, the total capacitance ... aliasing noises before it is converted to digital signals Lastly, as even a small deviation of the bioelectric signals is important in the diagnosis of a patient; an accurate analog-to-digital...
- 135
- 231
- 0
A Fast File System for UNIX
Ngày tải lên :
12/09/2012, 14:16
... fragments and a single unused fragment This remaining fragment can be allocated to another file as needed Space is allocated to a file when a program does a write system call Each time data is written ... the allocated space The problem with expanding a file one fragment at a a time is that data may be copied many times as a fragmented block expands to a full block Fragment reallocation can be minimized ... and the additions and changes that have been made to the facilities that are available to programmers The original UNIX system that runs on the PDP-11† has simple and elegant file system facilities...
- 14
- 1K
- 0
A web-based system for notifying environment violation.doc
Ngày tải lên :
27/10/2012, 16:40
... operating system - Easy to manage, update database: Database is located at dedicated server that managers can maintain and update it easily - Quick delivery: web-based model make it portable to ... Geographic Information system (GIS) is any system integrates hardware, software, and data for capturing, managing, analyzing, and displaying all forms of geographically referenced information ... 2.3.2.3 Data access tier It consists of the database server that contains all logic data of application Separating logic data from application into it will make program scalable and higher performance...
- 56
- 410
- 0
A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA
Ngày tải lên :
05/09/2013, 09:08
... provides practical information with reasonable accuracy, which can be used for environmental planning and management Open land use corresponds to low pollutant loads for all water quality parameters ... loading areas, which were classified as public land use in the SCAG data and USGS classification system Recreational facilities including parks were also classified as low pollutant loading areas, ... pollutant loads per unit pixel and unit rainfall for each water quality parameter i and α is a normalization factor that depends on units and conversion factors Table Runoff coefficient and EMCs for...
- 7
- 575
- 0
Tài liệu A Knowledge Management System for ERP Implementation pdf
Ngày tải lên :
16/01/2014, 16:33
... cooperative working platform, knowledge transfer platform, individual RESEARCH PAPER KM platform, organizational KM platform and consulting platform The interplay of these five platforms can speed ... Lastly, a KM system is proposed that consists of cooperative working platform, consulting platform, individual KM platform, organizational KM platform, and knowledge transfer platform This system ... classification is widely cited Explicit knowledge is transmittable in formal, systematic way It can be processed by a computer, transmitted electronically or stored in a database (Nonaka and Takenchi,...
- 12
- 622
- 1
Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc
Ngày tải lên :
20/02/2014, 21:20
... is that when they are formulated loosely, as in the previous paragraph, they appear to conflict In particular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a modifier ... Systems, ed P Jacobs, Lawrence Erlbaum Associates, Hillsdale, NJ, pp 13-33 Kameyama, M (1992) "The Syntax and Semantics of the Japanese Language Engine", forthcoming In Mazuka, R., and N Nagai, ... the fact that every lexical item has a semantics associated with it Table contains average edge counts and parse timing statistics for the 5875-utterance training set Many systems (Carbonell and...
- 8
- 376
- 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
Ngày tải lên :
16/03/2014, 01:20
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
- 9
- 444
- 0
The Design and Implementation of a Sequence Database System * docx
Ngày tải lên :
16/03/2014, 16:20
... on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database. In Proceedings of the International Conference on Very Large Databases(VWB), ... valueis created,or determinedautomatically by the system Catalog Management: Each E-ADT can provide catalogs that maintain statisticsand storeschemainformation Further, certain valuesmay be named Query ... supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational queriesto...
- 12
- 568
- 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx
Ngày tải lên :
17/03/2014, 10:20
... Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. , Hatayama, T & Nagata, ... such as Hsp10 5a and Hsp70 in various mammalian cells Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells acquire transient resistance to a ... neutral red, and fixed with 1% formaldehyde containing 1% CaCl2 for The dye incorporated into viable cells was extracted with 50% ethanol containing 1% acetic acid, and absorbance at 540 nm was measured...
- 8
- 470
- 0
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx
Ngày tải lên :
23/03/2014, 14:20
... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 2010), the question arises ... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... Dolan 2011 Collecting highly parallel data for paraphrase evaluation In ACL, pages 190–200 David Chiang 2007 Hierarchical phrase-based translation Computational Linguistics, 33(2):201–228 Pablo...
- 5
- 347
- 0
Báo cáo khoa học: "A Subcategorization Acquisition System for French Verbs" doc
Ngày tải lên :
31/03/2014, 00:20
... on Language Resources and Evaluation, volume IV, pages 1351–1357, Las Palmas de Gran Canaria, Spain Mihai Surdeanu, Sanda M Harabagiu, John Williams, and Paul Aarseth 2003 Using Predicate-Argument ... lexicon that contains partial subcategorization information (Sagot et al., 2006), while Dicovalence is a manually built valency dictionnary based on the pronominal approach (van den Eynde and Blanche-Benveniste, ... For more details of the lexicon and its format, see (Messiant et al., 2008) 3.3 Gold Standard Direct evaluation of subcategorization acquisition performance against a gold standard based on a...
- 6
- 391
- 0
báo cáo hóa học: "Introducing a feedback training system for guided home rehabilitation" potx
Ngày tải lên :
19/06/2014, 08:20
... measured force values For all parameters, the mean values as well as the variances were calculated For evaluating the differences in the parameters among different groups, analysis of variance (double-sided ... suitable for home rehabilitation training This is true for many other approaches as well [32-36] Page of 11 We therefore aimed to develop an easy to use, cheap and mobile training system that allows ... location of greatest stress a resistance strain gauge from Vishay [41] is applied to measure the bending of the material as a consequence of an applied force Strain gauges change their electrical...
- 11
- 524
- 0
Báo cáo hóa học: " Research Article CARNIVORE: A Disruption-Tolerant System for Studying Wildlife" docx
Ngày tải lên :
21/06/2014, 11:20
... receive data A single MAC layer task parses frames rapidly and updates the state variables for each task A neighbor table is maintained at each CSN that stores the neighbor ID and a ranking metric ... voltage Lithium batteries at 3.6 V are available in D, C, AA, and other sizes, and so this design will be able to accommodate a variety of form factors and sizes of batteries for small and large ... the data transfer task All nodes that sent nominations and received acceptances become senders in the data transfer task SRNs always have a metric of and will therefore always win an election and...
- 14
- 378
- 0
báo cáo hóa học:" Research Article A New Denoising System for SONAR Images" docx
Ngày tải lên :
21/06/2014, 20:20
... bishrink filter with global estimation of local variance, for the forth iteration it acts as a local adaptive Wiener filter and for the fifth iteration (the last one) it acts as a hard thresholding filter, ... International Conference on Acoustics, Speech and Signal Processing (ICASSP ’01), Salt Lake City, Utah, USA, May 2001 [23] S Moga and A Isar, “SONAR image denoising using a Bayesian approach in the wavelet ... not make a local estimation, was considered for the treatment of the Lena image in Table The second implementation makes a local estimation and has better performance It was considered for the...
- 14
- 326
- 0
Báo cáo hóa học: " A Multiple-Antenna System for ISM-Band Transmission" potx
Ngày tải lên :
23/06/2014, 01:20
... other approaches like fastICA [19] and SSARS [20] A Multiple-Antenna System for ISM-Band Transmission −1 0 In-phase −1 −1 −1 −1 Quadrature Quadrature 1 Quadrature Quadrature 1417 (a) In-phase ... In-phase Quadrature Quadrature Quadrature Quadrature 1 In-phase (b) −1 In-phase −1 −1 −1 −1 In-phase 1 Quadrature Quadrature The separation leads to data streams which are processed in the classical ... techniques There are two principal approaches to get a performance gain from an antenna array One approach uses the known geometric constellation of the antennas for beamforming The other approach is independent...
- 13
- 318
- 0
Market analysis and developing a competitive marketing strategy for selling medical solid waste wastewater treatment equipment to customers in vietnam
Ngày tải lên :
23/07/2014, 03:36
... 143 ABBREVIATIONS ADB Asian Development Bank AIC Advanced International Joint Stock Company APEC Asia – Pacific Economic Cooperation ASEAN Association of Southeast Asian Nations ATM Automatic ... expanding the total market and market share defense strategies Meanwhile, the market-challenger is always involved in attack strategies such as frontal attack, flank attack, encirclement attack, ... body parts, diagnostic samples, blood, chemicals, pharmaceuticals, medical devices and radioactive materials Hospital waste is very hazardous because it contains potentially harmful microorganisms...
- 254
- 590
- 2
Báo cáo sinh học: "he water flea Daphnia - a ‘new’ model system for ecology and evolution" potx
Ngày tải lên :
06/08/2014, 19:21
... comparative analysis of neural characters in higher crustaceans (malacostracans) and insects For example, in both insects and malacostracans, stem-cell-like neuroblasts have been detected that ... of Daphnia The study of parasites (viruses, bacteria and multicellular parasites) has also gained momentum as a result of their influence on Daphnia ecology and evolution [3] Parasites can directly ... populations Genetic variation has been reported in Daphnia for a vast number of traits such as size, aging, Page of behavior (for example, vertical migration, fish-escape behavior), morphology (for...
- 4
- 318
- 0