A proteomic approach for the identification of HCC serum biomarkers

... Tanaka et al., 2006; Twu et al., 1993) ; and upregulating amongst other signaling pathways, the Ras-Raf-MAPK signal transduction pathway, the JAK/STAT pathway and the protein kinase B pathway ... presentation of HCC, where the dearth of symptoms at the early stage of the disease results in detection of cancer only when at an advanced stage (Usatoff and Habib, 2002) Another is the paucity of ... specific for HCC and that can detect HCC early 1.1.9.1 The Search for New HCC Biomarkers In light of the limitations of AFP as a HCC biomarker, researchers have been actively searching for alternative...

Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx

... present a systematic approach for the identification of novel, serologically reactive markers of infection (in this case: VZV) The knowledge about the VZV serostatus is extraordinarily important for ... Pinto et al.: A systematic approach for the identification of novel, serologically reactive recombinant VaricellaZoster Virus (VZV) antigens Virology Journal 2010 7:165 Submit your next manuscript ... preanalyzed for the presence of VZV-IgG by the commercially available Enzygnost wcELISA (Dade Behring, Germany) All clinically defined serum samples were additionally chracterized for their VZV-IgG...

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

... of the sterility testing in compliance with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that is constituted of bone- marrow mononucleated cells used in ... using cell systems and in vivo assays using animal models As concerning the use of bone marrow mononucleated cells in cardiac repair, the importance of characterizing the functionality of injected ... is the validation of a commercial system (Charles River Endosafe PTS) for the determination of bacterial endotoxins in compliance with Eu Pharmacopoeia 2.6.14 (bacterial endotoxins), the validation...

Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx

... knowledge, represents the first in the literature describing a multidisciplinary approach for the successful management of a large metastasic GIST to the liver We attribute the success of this case to ... dilatation of the intrahepatic biliary radicals in the right lobe liver was performed, with placement of a right biliary drainage catheter for decompression The bilirubin and liver function tests at the ... lobe of multiple Computerized tomography A) and B); evaluation of the liver demonstrated a large inhomogeneous mass with multiple areas of cystic component within the left lobe of the liver The...

Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc

... as: D’Onofrio and An: A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA Theoretical ... of the initial concept for comparative analysis between the DHD and CHD and and drafted the initial version of the manuscript GA drafted portions of the manuscript and revised it critically for ... i.e for the subsequent use of the information It represents the necessary step for the utilization of stored information by the overall system In a computer, this function is performed by the hard...

Báo cáo y học: " A statistical model for the identification of genes governing the incidence of cancer with age" pptx

... not performed because no real data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted ... Aa fitted aa actual aa fitted 3 2 1 Time C 8 D 12 12 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of clones ... Aa actual Aa fitted aa actual aa fitted Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted Number of clones 3 2 1 Time C 8 D 12 11 10 AA actual AA fitted Aa actual Aa...

Báo cáo sinh học: "Therapeutic dendritic cell vaccine preparation using tumor RNA transfection: A promising approach for the treatment of prostate cancer" pps

... very small prostate tumors This, in association with radical prostatectomy and radiation therapies, has contributed to increasing the curative indexes [2] After several years of primary therapy, ... significant clinical benefits like disease stability in 80% of patients after 2–3 doses of vaccine The mean survival rate was 13 months for melanoma patients and months for renal cell carcinoma patients ... issue for DC vaccine RNA has the advantages of an efficient cytoplasmic expression allowing the use of total tumor antigens repertoire, and safe, because of its tran- sient expression allied...

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

... identiﬁcation and simulation A mathematical model was developed, representing central carbohydrate metabolism in leaves of A thaliana The model was based on the following system of ordinary differential ... in A thaliana A D B E C F Fig Maximum activities of enzymes in central carbohydrate metabolism during cold exposure (A C) Vmax values of three invertase isoforms: vInv, nInv and eInv (D) Vmax of ... (1999) Acclimation of Arabid¨ opsis leaves developing at low temperatures Increasing cytoplasmic volume accompanies increased activities of enzymes in the Calvin cycle and in the sucrose-biosynthesis...

Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx

... conclusions The statistical approach In this section, we will describe the two-pass statistical model, parameters training and Viterbi algorithm for the search of the best sequences of POS tagging ... one of the N-best POS tagging result of the sentence is: T = NN VBD RB CD NNS NN NN For this POS sequence, the 2nd pass will try to determine the baseNPs as shown in Figure The details of the ... possible brackets of "stock was down 9.1 points yesterday morning" Figure 3: the transformed form of the path with dash line for the second pass processing As required in our statistical model, we have...

Báo cáo khoa học: "A machine-learning approach to the identification of WH gaps" doc

... Illustration of the path a classifier must trace in order to identify the location of the gap from Figure At the top level, it must choose to recurse into the SQ node, and at the second level, into the ... downward from there, eventually predicting the location of the gap At each node we encounter, the classifier chooses either to recurse into one of the child nodes, or to predict the existence of a gap ... within the VP subtree it should predict the location of the gap as the last child of the parent VP SBARQ - begin at the first branching node dominating the WH operator, and train a classifier to...

Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

... ﬁrst ﬁnd the results of the core algorithm and then determine the effects of each enhancement The results are shown in Figure The last column in the graph shows the average across all the target ... Supertagging: an approach to almost parsing Comput Linguist 25, (Jun 1999), 237-265 Julia Birke 2005 A Clustering Approach for the Unsupervised Recognition of Nonliteral Language M.Sc Thesis School of Computing ... describe how we clean up the feedback sets to improve the performance of the Core algorithm We also introduce the notion of Learners & Voting Recall that neither the raw data nor the collected feedback...

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B...

Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx

... Surface area of the catalyst before and after use in the reaction was measured using surface area & pore size analyzer (NOVA 1000e, Quanta chrome Instruments) All the chemicals were used as-received ... [6], amines [7], and synthesis of azaheterocycles [8] are some of the synthetic applications of oximes They are also useful for selective a- activation [9] and are extensively used as intermediates ... method for the preparation of oximes The methodology also offers chemical, economical, and environmental advantages On the other hand, Bi2O3 is remarkably easier to use, nonhazardous, inexpensive and...

Báo cáo hóa học: "Research Article A Novel Semiblind Signal Extraction Approach for the Removal of Eye-Blink Artifact from EEGs" potx

... Nazarpour, S Sanei, and J A Chambers, A novel semiblind signal extraction approach incorporating PARAFAC for the removal of the removal of eye-blink artifact from EEGs,” in Proceedings of the ... clean signals coming from nonfrontal areas 3.3 Performance evaluations In order to provide a quantitative measure of performance for the proposed artifact removal method, the CC values of the ... for eye-blink artifact and a white Gaussian distributed signal as the background brain activity have been synthetically mixed The mixing matrix A (generated randomly from a standardized normal...

Xem thêm

Từ khóa: a sociotechnical approach for the design of a distributed community of practice a first approach for the production of human adipose tissue derived stromal cells for therapeutic use a unified statistical model for the identification of english basenp a new approach for the morphological segmentation of highresolution satellite imagery a rational strategy for the identification and testing of new agents a simplified method for the determination of bulldozing resistance a new approach for the morphological segmentation a new approach to the problem of human interrelations who shall survive a new approach to the problem of human interrelations a shell system for the generation of clinical documents 2 specifying a time delay for the application of archived redo log files use a defined constant for the size of an array cumulative specificity a universal mechanism for the initiation of protein synthesis evidence based medicine a new approach in the practice of medicine neuronal insulin receptor signaling a potential target for the treatment of cognitive and mood Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM