Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant

... 5′ GTGATTACGAAAAAGCATTTTGTGAAAAGGTTTTACC 3′ 5′ GGTAAAACCTTTTCACAAAATGCTTTTTCGTAATCAC 3′ E58 8A: 5′ GAAATGGTTGAAGGCAACAGCTGAAATTCCTACAGTAG 3′ 5′ CTACTGTAGGAATTTCAGCTGTTGCCTTCAACCATTTC 3′ The following ... CATTACTTGTTTGAAGGAATTTTGTGAAGCTGTTGTCTTCG 3' M2-R: 5' CGAAGACAACAGCTTCACAAAATTCCTTCAAACAAGTAATG 3' M3-F: 5' CATTACTTGTTTGAAGGAAACTGCAGAAGCTGTTGTCTTCG 3' M3-R: 5' CGAAGACAACAGCTTCTGCAGTTTCCTTCAAACAAGTAATG ... GGATCCCGGCGAATGATTATGAGA 3' CGCCCAAAGAGGTTTATG 3' ScAFT1 deletion AFT1 ABf: 5' TGAAGTATAAACCGCTAC 3' 28 Chapter Materials and methods AFT1 ABr: AFT1 CDf: AFT1 CDr: 5' GGATCCAGATGAATCAAATTGTTT 3' 5' GGATCCGGAAGAGTGGGATCGG...

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B...

báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx

... of proband Intraperitoneal tumor arising spontaneously in a Lewis rat has pathologic appearance of an ovarian adenocarcinoma (A) Proband shows tumor of the left ovary and intraperitoneal tumor ... D, Atkins L, Kato DT, Buczek-Thomas J, Fuller AF Jr, Hasan T: Characterization of a xenograft model of human ovarian carcinoma which produces intraperitoneal carcinomatosis and metastases in ... found in both normal ovarian epithelium and human ovarian carcinoma [40,41] Interleukin-18 (IL-18) is a proinflammatory cytokine that stimulates interferon-g production Ovarian carcinoma expresses...

Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx

... the protein Sip1 Sip1 is a nuclear splicing factor containing an arginine/serine-rich domain and a RNAbinding motif that may play a role in linking the processes of transcription and pre-mRNA ... participated in the design and revision of the study and performed the statistical analysis RP participated in the design and revision of the study AS participated in the analysis and interpretation ... of data and helped to draft the manuscript RR participated in the design of the study and in the revision of the manuscript EP participated in analysis of data GV participated in the design of...

Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

... staining (g) Intense staining of a hyperplastic RA synovial lining cell layer This staining was typical of most areas of RA synovium where the lining was hyperplastic (h) An area of an RA synovial ... stained positively (arrow) (e) Intense staining of individual cells in the lining layer of a typical OA synovium (f) An area of an OA synovium demonstrates a lining layer completely devoid of ... synovial lining layer and perivascular regions of RA (OCT section) tissue.(b) Intense staining of the synovial lining layer and perivascular regions of OA (paraffin section) tissue (c) An area demonstrating...

báo cáo khoa học: " Identification and characterization of plant Haspin kinase as a histone H3 threonine kinase" ppsx

... important for ATP binding, has no kinase activity [13] To examine whether purified GST-AtHaspin has kinase activity, an in vitro kinase assay was performed using purified GST-AtHaspin and GST-AtHaspin ... Dlk/ZIP kinase orthologues, and thus, AtHaspin has an additional role as a H3 Thr11 kinase in A thaliana Phosphorylation of histone H3 at Thr3 and Thr11 Mitotic phosphorylation of histone H3 at Ser10, ... (http://psort.nibb.ac.jp/form.html) Gray box indicates kinase domain (C) Multiple alignment of kinase domain of AtHaspin, human Haspin, and fission yeast Haspin Missing residues are shown as dashes, identical amino...

Báo cáo khoa học: "Identification and characterization of a new E3 ubiquitin ligase in white spot syndrome virus involved in virus latency" pot

... signaling pathways involved in latency regulation [25] As a RINGcontaining E3 ubiquitin ligase, WSSV403 is able to interact with its substrates besides E2 conjugating enzymes and to mediate degradation ... used, 403RING can be strongly activated as an E3 ligase by Pvubc, ubcH3, ubcH 5a, ubcH5c and ubcH6 (Fig 2B), indicating that 403RING can support E3 ligase activity and display a low degree of E2 specificity ... YL, Chang CF, Kou GH: Natural and experimental infection of white spot syndrome virus (WSSV) in benthic larvae of mud crab Scylla serrata Dis Aquat Organ 2000, 40(2):157-161 Page of (page number...

Báo cáo y học: "A steganalysis-based approach to comprehensive identification and characterization of functional regulatory elements" potx

... specificity and sensitivity (see Additional data file for a detailed analysis and more results) Identifying yeast cell-cycle regulatory motifs To evaluate the performance of WordSpy on biological ... analysis, WordSpy can comprehensively identify real motifs from a large set of regulatory sequences with a high specificity Identifying Arabidopsis cell-cycle regulatory motifs Cell-cycle regulation ... shown in the last column Genome Biology 2006, 7:R49 information MSA(YCYAACGGYY), MYB2(YAACKG), E2F(TTTYYCGYY), OCT(CGCGGATC), MYB(CNGTT), HEX(CCGTCG), MYCATRD22(CACATG) interactions 6.35E-02...

Identification and characterization of novel proteins from a rare australian elapid snake drysdalia coronoides

... Bibliography 195 Appendix 224 Publications 238 vi Summary Identification and characterization of novel proteins from a rare Australian elapid snake Drysdalia coronoides Partial transcriptome from ... venomous terrestrial snakes of the Elapidae family have undergone an extensive radiation in Australia [12] Elapid snake genus Drysdalia from southern Australia is a group of rare snakes comprising ... islands of Ireland, Iceland and New Zealand [5, 6] They have successfully colonized various habitats and feed on small animals including lizards, snakes, rodents, small mammals, birds, eggs and...

Identification and characterization of a novel heart reactive autoantibody in systemic lupus erythematosus possible serological marker for early myocardial dysfunction

... overall incidence was found in Iceland and Japan and highest in USA and France The overall prevalence was the lowest in Northern Ireland, UK and Finland, and the highest in Italy, Spain and Martinique ... IDENTIFICATION AND CHARACTERIZATION OF A NOVEL HEART- REACTIVE AUTOANTIBODY IN SYSTEMIC LUPUS ERYTHEMATOSUS: POSSIBLE SEROLOGICAL MARKER FOR EARLY MYOCARDIAL DYSFUNCTION XU QIAN (M Med., Shanghai ... LIST OF ABBREVIATIONS ACA anticardiolipin antibodies ACR American College of Rheumatology ACHA anticholesterol antibody aCL anticardiolipin antibodies ANA antinuclear autoantibody ANP atrial natriuretic...

Identification and characterization of iron homeostasis related genes and HCC down regulated mitochondrial carrier protein (HDMCP), a novel liver specific uncoupling protein in human hepatocellular carcinoma (HCC

... IDENTIFICATION AND CHARACTERIZATION OF IRON HOMEOSTASIS- RELATED GENES AND HCCDOWN -REGULATED MITOCHONDRIAL CARRIER PROTEIN (HDMCP), A NOVEL LIVER- SPECIFIC UNCOUPLING PROTEIN IN HUMAN HEPATOCELLULAR ... 5’-RACE β2m mitochondrial membrane potential 5'-rapid amplification of cDNA ends β2-microglobulin aa AAH AFP ALAS ANOVA ATP amino acid atypical adenomatous hyperplasia α-fetoprotein δ-aminolevulinate ... value of protein induced by vitamin K absence (PIVKAII) and hepatoma -specific band of serum gamma-glutamyl transferase (GGTII) as hepatocellular carcinoma markers complementary to alphafetoprotein...

Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics

... acidic proteins (Hathaway and Traugh, 1982) Two distinct casein kinases have been found in many different cell types They have been designated casein kinase (CK1) and casein kinase (CK2) according ... Ca2+/calmodulin-dependent protein kinase II cAMP cyclic adenosine monophosphate Cdk cyclin-dependent kinase Cdk5 cyclin-dependent kinase cDNA complementary deoxyribonucleic acid CK1 casein kinase CK2 casein kinase ... interacting proteins Using the former approach, the catalytic α subunit of protein kinase CK2 (formerly known as casein kinase 2) was isolated from rat brain extracts The direct associations of CK2 with...

Roles of siRNAs and miRNAs in host responses to virus infection identification and characterization of a novel viral suppressor of RNA silencing

... demonstrated as a natural antiviral defense in plants Is RNAi also antiviral in animals? Flock house virus (FHV), which can infect both animals and plants, was demonstrated as both an initiator and a ... biogenesis and possible roles of miRNAs and siRNAs 1.3.8 Viral suppressor and miRNA-controlled developmental pathway interaction After discovering miRNAs in plants, researchers started to investigate ... which contains an ATP-dependent RNA helicase, a PAZ domain, two RNaseIII domains and a dsRNA-binding domain, have been identified in Arabidopsis (Park et al., 2002), C elegans (Ketting et al., 2001;...

IDENTIFICATION AND CHARACTERIZATION OF a PLASMODIUM VIVAX INHIBITOR OF CYSTEINE PROTEASES

... vivax, Plasmodium malariae, Plasmodium ovalae and Plasmodium knowlesi, of which, P vivax is the most widespread causative agent 2.1.1 Plasmodium vivax is a neglected causative agent of human malaria ... of severe clinical diseases as a result of P vivax infection Severe and fatal P vivax malaria cases have been described in many endemic countries, e.g Malaysia, Indonesia and Papua New Guinea ... facilitate parasite survival and invasion (Santos et al., 2006) 35 2.3.3 Inhibitors of cysteine proteases in Plasmodium parasites Cysteine proteases from both the Plasmodium parasites and human...

Xem thêm

Từ khóa: thermal oxide synthesis and characterization of fe3o4nanorods and fe2o3 nanowires isolation and characterization of vascular endothelial cells from murine heart and lung isolation and characterization of embryonic and adult epicardium and epicardium derived cells contractors—identification and recoupment of improper and potentially fraudulent payments and cms s oversight and response collection screening and characterization of microalgae collection screening and characterization of microalgae by seri in house researchers methods for the purification and characterization of human adipose derived stem cells the nature and extent of sacred doctrine year items with a short production cycle and those with a long production cycle shall be disclosed separately within the asset line item b ii as 3 work in progress and 4 finished goods in the standard format balance sheet natural mould and soil of a garden development of a regional risk management framework for apec economies for use in the control and prevention of introduced marine pests the life and death of a rogue ap implementing a characterization of genre ebusiness and manufacturing sector a study of small and mediumsized enterprises in india structure and function of a dogs eye Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ