0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands synthesis, structures, properties and catecholase activity 3

Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands  synthesis, structures, properties and catecholase activity 4

Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands synthesis, structures, properties and catecholase activity 4

... 2.051 (4) Ni(1) -N( 1) 2.0 84( 4) Ni(1)-O(1) 2.089 (4) Ni(2)-O( 14) 2.039 (4) Ni(2)-O(7) 2. 042 (4) Ni(2)-O(5)a 2. 048 (4) Ni(2)-O(13) 2.070(3) Ni(2)-O(6) 2.101(3) O(5)-Ni(2)b 2. 048 (4) O( 14) -Ni(2)-O(5)a 89. 4( 2) ... oxygen atom (Ni(1)-O(2), 2. 047 (4) Å and Ni(2)O(7), 2. 042 (4) Å) in a facial manner, two aqua ligands and another carboxylate oxygen from the neighboring molecule Selected bond lengths and bond angles ... HSglu2- ligand coordinated through phenolic oxygen atom (Ni(1)-O(1), 2.089 (4) Å and Ni(2)-O(6), 2.101(3) Å) and secondary amine N atom (Ni(1) -N( 1), 2.0 84( 4) Å; Ni(2) -N( 2), 2.082 (4) Å) and the α-carboxylate...
  • 22
  • 216
  • 0
Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands  synthesis, structures, properties and catecholase activity 3

Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands synthesis, structures, properties and catecholase activity 3

... C12H17NNiO4S C22H2 6N4 NiO8 f.w 35 0.81 38 1.84 31 3. 93 330 .04 533 .18 T/K 22 3( 2) 22 3( 2) 22 3( 2) 22 3( 2) 22 3( 2) λ/Å 0.710 73 Å 0.710 73 0.710 73 0.710 73 0.710 73 Crystal system Monoclinic Monoclinic Orthorhombic ... improving the structural insights in terms of hydrogen bonding tendencies of the amino acid components 3- 5 Experimental 3- 5-1 Synthesis of ligands N -(2- hydroxybenzyl)- L-aspartic acid, H3Sas To ... Low-frequency Vibrations of Inorganic and Coordination Compounds, Plenum press, New York, 1971; (b) Nakamato, K Infrared and Raman Spectra of Inorganic and Coordination Compounds, 4th edn., John Wiley...
  • 35
  • 214
  • 0
Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands  synthesis, structures, properties and catecholase activity 2

Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands synthesis, structures, properties and catecholase activity 2

... noradrenaline and dopa.8 Oxidation of mono- and diphenol-containing neurotransmitters such as dopamine, epinephrine, norepinephrine and serotonin have been found associated with the Fe(II) and Cu(II) ... hydrogen bonds generate 3D hydrogen bonded network connectivity in IIA-4 Hydrogen bond distances and angles are shown in Table 2- 8 A portion of the hydrogen bonding connectivity in IIA-4 has been ... as in IIA-2a giving the Cu-O bond distances in the range 2. 21 3 (2) -2. 660(3) Å The common 1-aminocyclopentanecarboxylate side arm of the ligands in IIA-1a, IIA-2a, IIA-3a and IIA-4 resulted in the...
  • 128
  • 340
  • 0
Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands  synthesis, structures, properties and catecholase activity

Cu(II) and Ni(II) complexes of n (2 hydroxybenzyl) amino acid ligands synthesis, structures, properties and catecholase activity

... acid H2Saes N- (2- hydroxysalicylidene)-aminoethanesulfonic acid H2Sam N- (2- hydroxybenzyl)- aminomethanesulfonic acid H2Sae N- (2- hydroxybenzyl)- aminoethanesulfonic acid H2Sas N -(2- hydroxybenzyl)- L-aspartic ... salicylaldehyde and amino acids have focused upon the tridentate ligand binding mode of these ligands. 18-19 Transition metal complexes of N- (2hydroxysalicylidene) -amino acid ligands have been shown to behave ... complexes of tridentate ligand containing substituted phenyl ring.72 Apart from several phenoxo and acetato bridged multinuclear Ni(II) complexes containing N- (2- hydroxybenzyl)- ethanolamine and N- (2- hydroxybenzyl)- ...
  • 82
  • 583
  • 0
Metal complexes of n (7 hydroxyl 4 methyl 8 coumarinyl)  amino acid, n (2 pyridylmethyl) amino acid and related ligands synthesis, structural, photophysical and gelation properties

Metal complexes of n (7 hydroxyl 4 methyl 8 coumarinyl) amino acid, n (2 pyridylmethyl) amino acid and related ligands synthesis, structural, photophysical and gelation properties

... N- (7- hydroxy -4- methyl- 8- coumarinyl)- L-serine N- 2( -pyridylmethyl)- aminoethanesulfonic acid N- (2- pyridylmethylene)-aminoethanesulfonic acid N- 2( -pyridylmethyl)- L-alanine N- 2( -pyridylmethyl)- b -alanine N- (2- pyridylmethylene)-b-alanine ... N- (2- pyridylmethylene)-b-alanine N- (2- pyridylmethyl)- L-glutamic acid N- (2- pyridylmethyl)- glycine N- (2- pyridylmethyl)- L-histidine N- (2- pyridylmethyl)- L-serine N- (2- hydroxybenzyl)-aminoethanesulfonicacid N- (2- hydroxybenzyl)-L-alanine ... scanning electron microscopy hour N- (7- hydroxy -4- methyl- 8- coumarinyl)- L-alanine N- (7- hydroxy -4- methyl- 8- coumarinyl)- glycine 4- methylumbelliferone -8- methyleneiminodiacetic acid / Calcein Blue N- (7- hydroxy -4- methyl- 8- coumarinyl)- L-serine...
  • 276
  • 485
  • 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf

Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf

... towards N- acetyl-D-methionine, N- acetyl-D-alanine, N- acetyl-D-leucine and N- chloroacetyl-D-phenylalanine than towards N- acetyl-D-valine, N- acetyl-D-phenylalanine, N- acetyl-D-tryptophan, N- acetyl-D-tyrosine ... A- 6-D50061: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N- acyl D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax ... proteins A- 6-D45918: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acyl -D-amino acid amidohydrolase; A- 6-D45919: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acyl-D-Asparate amidohydrolase; A- 6-D50061:...
  • 11
  • 656
  • 0
Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

... N-Methyl-L-amino acid dehydrogenase from P putida H Mihara et al ammonia are formed from methylamine and glutamate by N-methylglutamate synthase (EC 2.1.1.21) [16] Another A aminovorans strain, ... were of analytical grade from Nacalai Tesque (Kyoto, Japan) and Wako Pure Chemical Industries (Osaka, Japan) Culture and screening of bacteria Bacterial strains were cultivated for 1520 h at 30 ... Japan) Restriction enzymes and kits for genetic manipulation were from Takara Shuzo (Kyoto, Japan), Toyobo (Osaka, Japan), and New England Biolabs (Beverly, MA, USA) All other reagents were of...
  • 7
  • 518
  • 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... both the wild-type protein and mutants E142O and K13 3A Thermal analysis of protein unfolding The DSC curves of the wild-type protein and the mutants K13 3A, E142O, W14 0A and W140O are shown in Fig ... Our CD and DSC data show that the W140 in SNase is the amino acid responsible for the stability of the whole protein However, in comparison with the wild-type protein, the mutant W14 0A retains significant...
  • 7
  • 551
  • 0
Báo cáo khoa học: Substrate specificity and transport mode of the proton-dependent amino acid transporter mPAT2 potx

Báo cáo khoa học: Substrate specificity and transport mode of the proton-dependent amino acid transporter mPAT2 potx

... transporter to the internal membrane side is the rate-limiting step and not – as proposed for most of the other electrogenic symporters – the return of the unloaded transporter to the outside of the membrane ... interpreted as the first evidence for a restricted velocity in the translocation step of the loaded transporter by the sterical conformation of the substrate The introduction of polar side groups in the ... properties of mPAT2 (Eur J Biochem 271) 3343 Table Apparent substrate affinities and transport currents of amino acids and derivatives as well as the corresponding inhibitory effect on the uptake of the...
  • 8
  • 541
  • 0
Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc

Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc

... CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG ... CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGTATTCTGCTGCCCACACCAG 2B4F33Y 2B7Y33 L 2B7Y33F 1262 FEBS Journal 274 (2007) 1256–1264 ª 2007 The ... the critical importance of an aromatic amino acid at position 33 for the activity and substrate specificity of both UGT2B4 and UGT2B7 Results The phenylalanine residue at position 33 of UGT2B4 is...
  • 9
  • 343
  • 0
Báo cáo khoa học: Cloning and functional characterization of Arabidopsis thaliana D-amino acid aminotransferase – D-aspartate behavior during germination pdf

Báo cáo khoa học: Cloning and functional characterization of Arabidopsis thaliana D-amino acid aminotransferase – D-aspartate behavior during germination pdf

... appearance of other d-amino acids This is the first report, for eukaryotes, of cDNA cloning and functional characterization of d-AAT acid aminotransferase in A thaliana tion rate of main roots and hypocotyls ... between d-amino acids, was cloned and characterized This represents the first cDNA cloning and functional characterization of a d-AAT of eukaryotic 1196 origin Further characterization of this ... completely abolished activity, suggesting that A thaliana d-AAT is a Discussion D-Amino acids in A thaliana Free d-amino acids and conjugated forms of d-amino acids have been detected in higher plants...
  • 13
  • 401
  • 0
DESIGN, SYNTHESIS AND STUDY OF DNA-TARGETED BENZIMIDAZOLE-AMINO ACID CONJUGATES

DESIGN, SYNTHESIS AND STUDY OF DNA-TARGETED BENZIMIDAZOLE-AMINO ACID CONJUGATES

... Research Integrity and Copyright Disclaimer Title of Thesis/Dissertation: Design, Synthesis and Study of DNA-Targeted Benzimidazole-Amino Acid Conjugates For the degree of Master of Science Choose ... http://www.purdue.edu/policies/pages/teach_res_outreach/c_22.html DESIGN, SYNTHESIS AND STUDY OF DNA-TARGETED BENZIMIDAZOLE-AMINO ACID CONJUGATES A Thesis Submitted to the Faculty of Purdue University by Matthew L Garner In Partial Fulfillment of the ... 1.6 Plan of Study 23 v Page 1.7 List of References 25 CHAPTER DESIGN AND SYNTHESIS OF AMINO ACID- BENZIMIDAZOLEAMIDINE CONJUGATES 30 2.1 Design of Amino Acid- Benzimidazole-Amidine...
  • 144
  • 301
  • 1
Solid-Phase Synthesis of N-Carboxyalkyl Unnatural Amino Acids

Solid-Phase Synthesis of N-Carboxyalkyl Unnatural Amino Acids

... Evaluation of Alkyl Halides in the Synthesis of Unnatural Amino Acids .43 3.3 Combinatorial Synthesis of N-Carboxyalkyl Amino Acid Analogs 44 3.4 Deprotection of Benzyl-Protected N-Carboxyalkyl Amino ... 2010, Solid-Phase Synthesis of N-Carboxyalkyl Unnatural Amino Acids Major Professor: Martin J 9^/NMMEKl, Ph.D A novel route has been developed for the solid-phase synthesis of Ncarboxyalkyl unnatural ... Title of Thesis/Dissertation: Solid-Phase Synthesis of N-Carboxyalkyl Unnatural Amino Acids Master of Science For the degree of I certify that in the preparation of...
  • 257
  • 322
  • 0
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx

Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx

... D-phenylalanine and D-tryptophan Like the wild-type DAAO, basic D-amino acids are poor substrates for Y2 38 mutants (data not shown) The mutants maintain the stereospecicity of the wild-type RgDAAO; ... size of the ligand side chain [27] Our results indicate that the role of Y2 23 and Y2 38 in the active site of RgDAAO is different from that of the tyrosine residues (Y2 24 and Y2 28) of pkDAAO In fact, ... that the overall substrate-binding pocket remains intact, as all mutants bind the same ligands as the wild-type (Table 2) The steady state parameters determined with various D-amino acids at a...
  • 10
  • 496
  • 0
Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

... suppress its protease inhibitory properties, we show that the antibacterial ⁄ fungicidal action of trappin-2 is independent of its antiprotease function Although we have not determined its exact ... that trappin-2, and to a lesser extent elafin, have broad antibacterial and antifungal properties that are independent of their antiprotease function and probably limited to conditions of low ionic ... mechanism of action, we have shown that the antibacterial ⁄ fungicidal properties of trappin-2 involve the cationic nature of the molecule, as assessed from the salt and heparin dependence of the antimicrobial...
  • 13
  • 610
  • 0

Xem thêm

Từ khóa: equilibrium constants and changes in thermodynamic properties for formating of cucl 2 and cucl23 from cucl s ncl cucln n 1equilibrium constants and changes in thermodynamic properties for formation of cucl 2 and cucl23 from cu ncl cucln n 1total crosspoints ³ 4n 2n 1 2 1 ³ 174 886 with less than 200 000 crosspoints we can design a three stage switch we can use n n 2 1 2 23 and choose k 45 the total number of crosspoints is 178 200iron ii and ruthenium ii complexes of 4 apos substituted 2 2 apos 6 apos 2 apos apos terpyridine ligandsr et wiederholt j b 1996 contextual factors and the cooperativeness of conflict resolution strategies in interfirm relationships journal of marketing channels vol 5 n 2 1 24l et black g s the effects of relationalism and supplier replaceability on industrial distribution channel outcomes journal of marketing channels 1996 vol 5 n 2 25 44rae amp right ventricular hypertrophy rvh khfrank g yanowitz m d rae is recognized by the tall gt 2 5mm p waves in leads ii iii avf rvh is likely because of right axis deviation 100 degrees and the qr or rsr apos complexes in v1 2and remove rows from the database phần 2performing a sql select statement and storing the rows locally phần 2executing select statements and tabledirect commands phần 2an example of using the get methods phần 2adding restrictions to datatable and datacolumn objects phần 2windows and how to work them phần 2moving and copying icons phần 2protecting sam and security hives phần 2chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ