0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Regulation of DNA (cytosine 5) methyltransferase 1 in the cell cycle and its role(s) in doxorubicin mediated micronuclei formation

Regulation of DNA (cytosine 5) methyltransferase 1 in the cell cycle and its role(s) in doxorubicin mediated micronuclei formation

Regulation of DNA (cytosine 5) methyltransferase 1 in the cell cycle and its role(s) in doxorubicin mediated micronuclei formation

... over-expression of p21WAF1 inhibits DNMT1 73 3 .1. 1.7 TSA -mediated induction of p21WAF1 results in inhibition of 76 DNMT1 3 .1. 1.8 TSA -mediated induction of p21WAF1 is independent of p53 85 3 .1. 2 Transcriptional ... between DNMT1 and p21WAF1 in the 63 cell cycle 3 .1. 1 .1 3 .1. 1.2 DNMT1 expression in the cell cycle 63 WAF1 in DNA 67 p21WAF1 68 Transient over-expression of DNMT1 does not inhibit 71 Inverse relationship ... methylase 17 1. 3.3b DNMT1 interacts with Polycomb Group (PcG) proteins 17 1. 3.3c DNMT1 interacts with UHRF1 18 Transcriptional suppression 19 1. 3.4 iv 1. 4 DNMT1 in the Cell Cycle 1. 4 .1 21 1.4.2 E2F1/RB...
  • 208
  • 387
  • 0
The roles of DNA(cytosine 5) methyltransferase1 in carcinogenesis related to cellular factors, virus and chemicals

The roles of DNA(cytosine 5) methyltransferase1 in carcinogenesis related to cellular factors, virus and chemicals

... proteins E1 protein E1 protein is mainly involved in the replication of the virus by binding to the origin of replication (ori) in the 3’ end of the LCR (Ustav et al., 1991) It is shown to possess ... dependent binding 57 2.22 Cell staining 57 2.22.1 Staining of Hsc70-PCNA 57 2.22.2 Staining of transfected DNMT1 and Hsc70 58 2.22.3 Staining of DNMT1 and YY1 58 2.22.4 Staining of DNMT1 and Hsc70 in ... Cterminus substrate-binding domain The binding site of Hsc70 was localized to aa141-152, probably to the PXPXP sequence at the N-terminus of DNMT1 The presence of an additional 17aa inserted in the...
  • 282
  • 278
  • 0
Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot

Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot

... increases the growth rate and shortens the duration of the cell cycle is the polymer-inherent isosterism of the carboxylates with the array of phosphates in nucleic acids and, consequently, the ... the mechanism(s) underlying the increase in the growth rate and the shortening of the cell cycle might be related to the ability of PMLA to form complexes with nucleic acid binding proteins and ... levels of PMLA induced a strain specific enhancement of cell growth and an equal (between strains) shortening of the cell cycle Materials and methods Strains and materials The following strains of...
  • 7
  • 325
  • 0
Báo cáo y học:

Báo cáo y học: " Single cell studies of the cell cycle and some models" pps

... exponential is the paradigm for the cell cycle Tetrahymena pyriformis has a long and distinguished history in the cell cycle with its early induction synchrony But in the 1960s there was a burst of studies ... variation in cycle stage and this can obscure the fine detail of the cycle Single cell measurements may help here Single cell analysis in yeast Returning to single cell analyses of fission yeast, volume ... they made a measurement of the dry mass of single cells by interferometry and then placed it in the cycle by following it as it moved about until it divided The difference in timing between the...
  • 5
  • 289
  • 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

... evaluation of heme dynamics in cultured cells Role of heme metabolism in cellular heme content Regulatory role of free heme in expression of HO-1 To evaluate the contribution of heme synthesis and ... HO-1 protein was also induced by the treatment with HO-2 siRNA in HepG2 cells These results indicate that the down-regulation of HO-2 expression is associated with induction of HO-1 expression ... protein, in comparison with the low expression of HO-1 protein, in H146 small cell lung cancer cells is of particular interest because small cell lung cancer is derived from the airway neuroepithelial...
  • 14
  • 487
  • 0
Báo cáo khoa học: Auto-methylation of the mouse DNA-(cytosine C5)-methyltransferase Dnmt3a at its active site cysteine residue pot

Báo cáo khoa học: Auto-methylation of the mouse DNA-(cytosine C5)-methyltransferase Dnmt3a at its active site cysteine residue pot

... between the enzyme and the substrate base The formation of the cysteine cytosine bond increases the negative charge density at the C5 atom of the cytosine, which then attacks the methyl group bound ... orange, Dnmt3a colored by atom type The distance between the sulfhydryl atom of the catalytic cysteine side chain and sulfur ˚ atom of AdoHcy (7.66 A) is indicated On the other hand, they harbor a cysteine ... that the catalytic cysteine residue was the methyl group acceptor because it lies in close proximity to the methyl group of AdoMet and is the most reactive residue in the catalytic center of the...
  • 9
  • 437
  • 0
Báo cáo y học:

Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps

... Primers and probes 11 β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC ... GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC ... inflammation Conclusion Stromal cells play a pivotal role in normal, physiological inflammation and persistent inflammatory disease by expressing factors such as cytokines and chemokines that...
  • 10
  • 438
  • 0
Investigations on the roles of ubiquitin in the regulation of heat shock gene HSP70B 1

Investigations on the roles of ubiquitin in the regulation of heat shock gene HSP70B 1

... INVESTIGATIONS ON THE ROLES OF UBIQUITIN IN THE REGULATION OF HEAT SHOCK GENE HSP70B EE THIAM HEE, GARY NATIONAL UNIVERSITY OF SINGAPORE 2 011 INVESTIGATIONS ON THE ROLES OF UBIQUITIN IN THE ... THE REGULATION OF HEAT SHOCK GENE HSP70B EE THIAM HEE, GARY (B SCI (HONS), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF MICROBIOLOGY YONG LOO LIN SCHOOL OF MEDICINE ... DOCTOR OF PHILOSOPHY DEPARTMENT OF MICROBIOLOGY YONG LOO LIN SCHOOL OF MEDICINE NATIONAL UNIVERSITY OF SINGAPORE 2 011 ...
  • 3
  • 299
  • 0
Tài liệu Báo cáo khoa học: Regulation of DNA fragmentation: the role of caspases and phosphorylation doc

Tài liệu Báo cáo khoa học: Regulation of DNA fragmentation: the role of caspases and phosphorylation doc

... signal on and off Caspase activation is under the direct control of kinases and phosphatases, and the indirect control of phosphorylation through the regulation of other apoptotic proteins Furthermore, ... activity of the MAPK family mediates the downregulation of various phosphorylations, such as those of mitochondrial Phosphorylation and caspases in DNA fragmentation proteins, caspases and MAPK themselves ... -8, -9 and -10) and the executioner caspases (consisting of caspases- 3, -6 and -7) The functional forms of initiator caspases directly or indirectly promote activation of the executioner caspases...
  • 15
  • 784
  • 0
Tài liệu Báo cáo khoa học: Down-regulation of reduced folate carrier may result in folate malabsorption across intestinal brush border membrane during experimental alcoholism docx

Tài liệu Báo cáo khoa học: Down-regulation of reduced folate carrier may result in folate malabsorption across intestinal brush border membrane during experimental alcoholism docx

... mechanisms of regulation of folate malabsorption during chronic alcoholism Under chronic alcoholic conditions, the kinetic constants of the folate transport process in intestinal brush border membrane ... the intestinal membrane [12,20] In a rat model of experimental alcoholism, we examined the mechanism of the regulation of folate transport mediated by RFC, the major folate transporter protein in ... decrease in the degree of methylation of DNA in chronic ethanolfed rats 6322 Chronic alcoholism is often associated with folate deficiency, which is mainly a result of malabsorption of folate across...
  • 12
  • 484
  • 0
Regulation of Water Pollution from Hydraulic Fracturing in Horizontally-Drilled Wells in the Marcellus Shale Region, USA pot

Regulation of Water Pollution from Hydraulic Fracturing in Horizontally-Drilled Wells in the Marcellus Shale Region, USA pot

... until there is proof of fracturing contaminants in surface waters [13] Congress acted to protect drinking water in the Safe Drinking Water Act of 1976 with protection through the implementation of ... provisions of the Safe Drinking Water Act would offer additional oversight to fracturing activities involving chemicals being injected into the ground In addition, requiring mandatory reporting of chemicals ... Moreover, since hydraulic fracturing in the Marcellus shale region leads to increased concentrations of Ra226, Ra228, and Ba in flowback waters from Marcellus wells [53], more definitive and demanding...
  • 12
  • 422
  • 0
Báo cáo khoa học: Differential regulation of fatty acid amide hydrolase promoter in human immune cells and neuronal cells by leptin and progesterone pdf

Báo cáo khoa học: Differential regulation of fatty acid amide hydrolase promoter in human immune cells and neuronal cells by leptin and progesterone pdf

... of leptin and progesterone on FAAH activity and expression (A) Effect of leptin on the activity of FAAH in human U937 and CHP100 cells and on the protein content and the mRNA of FAAH in U937 cells ... triggered by leptin or progesterone in immune cells are missing in neuronal cells On the other hand, it is also possible that silencers of FAAH gene expression are present in neuronal cells but not in ... and proliferation of immune and neuronal cells; processes in which AEA and the endocannabinoid system are also involved [19] In particular, leptin and progesterone, by stimulating AEA degradation...
  • 11
  • 468
  • 0
Báo cáo Y học: The DNA-polymerase inhibiting activity of poly(b-L-malic acid) in nuclear extract during the cell cycle of Physarum polycephalum pot

Báo cáo Y học: The DNA-polymerase inhibiting activity of poly(b-L-malic acid) in nuclear extract during the cell cycle of Physarum polycephalum pot

... except of DNA polymerase b-like, are inhibited by PMLA contained in the extracts The inhibitory activity during the cell cycle The inhibitory activity during the cell cycle was measured in the presence ... mitosis Thus, the in vivo and in vitro activities of DNA synthesis corresponded with the minimum of the inhibitory activity in the cell cycle The activity of DNA polymerases in the nuclear extracts ... activity in the cell cycle The in vivo activity of DNA polymerases The cell cycle dependence of DNA polymerase activity was followed under in vivo conditions The incorporation of radioactivity into...
  • 6
  • 347
  • 0
Báo cáo Y học: Function and cellular localization of farnesoic acid O -methyltransferase (FAMeT) in the shrimp, Metapenaeus ensis ppt

Báo cáo Y học: Function and cellular localization of farnesoic acid O -methyltransferase (FAMeT) in the shrimp, Metapenaeus ensis ppt

... role of MF in the molting process of the crustaceans [31–33] Therefore, to ascertain the expression of FAMeT in relation to the molting process of the shrimp, we determined the level of expression ... biological function of this gene The refolding of the protein during renaturation is important for the function of the enzyme When we used recombinant protein renatured following purification under ... throughout the molting cycle suggests that FAMeT may be involved in molting or related processes in the shrimp Finally, the present work provides a framework for study of the regulation of biosynthesis...
  • 9
  • 375
  • 0
Báo cáo y học:

Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx

... of IP-10 in RA synovitis, because most of the leukocytes infiltrating the SF of rheumatoid joints are PMNs PMNs in the RA SF are in an activated state, and produce a variety of other inflammatory ... a potent angiogenic factor, namely vascular endothelial growth factor, was markedly induced by the interaction of FLS with synovial leukocytes via the integrin/ICAM-1 pathway [19] Taken together, ... study, RA SF contained greater amounts of IP-10 as compared with OA SF Immunolocalization analysis indicated that IP-10 was associated mainly with infiltrating macrophage-like cells, and fibroblast-like...
  • 8
  • 446
  • 0

Xem thêm

Từ khóa: methyltransferase 5 methylcytosine dna glycosylase and sirna pathway related protein in the mutator phenotype and its progeniesplot summary of macbeth act 5 scene 1prl 1 overexpression alters the microrna expression profile of hek293 cells and leads to down regulation of micrornas that target prl 1 and its downstream pathwaystable 2 1 purpose of the expression interface and its implementerstable a 1 purpose of the expression interface and its implementersquantitative analysis of liver golgi proteome in the cell cycle76 464 eec dsd discharge of dangerous substances to the aquatic environment and its daughter directives  in particular 86 280use set variable to enter the property of a movie clip in the variable field and its new value in the value field1 electrical activity of the heart the action potential and its propagationthe creation of the federal reserve and its role in creating our bailout nationsimilarities and differences of idioms containing the word heart and its synonyms in vietnamese in the light of cultureof the english course and its objectives in the department of foreign languages hyutebài 1 read the following passage and mark the letter a b c or d to indicate the correct answer for each of the questions5α dht increased herg protein abundance at the cell surface and in the intracellular compartmentsc c increases the population of alt cells in g2 m phase of the cell cycleNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ