Accurate and sensitive determination of selected contaminants from food packaging materials
Accurate and sensitive determination of selected contaminants from food packaging materials
... implementation of food safety policies This thesis will cover two broad areas of contaminants from food contact materials: Determination of the migration of bisphenolic monomers from canned coatings into food, ... migration of various types of toxic contaminants from food packaging materials into oily, aqueous and acidic food matrices The first part of the project focuses largely on the development and optimization ... Migration of monomers / additives from polymers used in food contact materials 1.6 State -of- the-art analytical methods for determining amount of 18 contaminants from food packaging materials...
- 209
- 208
- 1
Báo cáo khoa học: "Prognosticators and Risk Grouping in Patients with Lung Metastasis from Nasopharyngeal Carcinoma: A more accurate and appropriate assessment of prognosis" doc
... this article as: Cao et al.: Prognosticators and Risk Grouping in Patients with Lung Metastasis from Nasopharyngeal Carcinoma: A more accurate and appropriate assessment of prognosis Radiation ... CY, Huang AT: Examining prognostic factors and patterns of failure in nasopharyngeal carcinoma following concomitant radiotherapy and chemotherapy: impact on future clinical trials Int J Radiat ... number of metastases and secondary metastases Comparison of lung metastasis survival (LMS) according to age (A) , VCA-IgA titre (B), number of metastases (C), and secondary metastases (D) Cao et al...
- 10
- 621
- 0
Feasibility study of removal of surface contaminants from solid surfaces using water jets with bubbles and ultrasound
... FEASIBILITY STUDY OF REMOVAL OF SURFACE CONTAMINANTS FROM SOLID SURFACES USING WATER JETS WITH BUBBLES AND ULTRASOUND MUHAMMAD FADZLI B HASSAN (B.ENG (HONS), NATIONAL UNIVERSITY OF SINGAPORE) ... The Measurement of Impact and Shear Stresses of Impinging Bubbles 146 7.6 Investigation V: The removal of surface contaminants from an etched surface with bubbles and ultrasound ... Investigation VI: The removal of surface foulants and contaminants from an etched surface with bubbles and ultrasound 6.1 The removal of microalgal biofilms by non-cavitating bubbles 112 6.1.1 Introduction...
- 218
- 464
- 0
Characteristics of hydrogen production from food waste and waste activated sludge
... for 3.0 and 5.0 % of total VS concentrations could not be conducted because of low VS concentration of sewage sludge 20 mL of seed sludge and appropriate amounts of food waste and sewage sludge ... produce moles of hydrogen with mole of n-butyrate or moles of hydrogen with mole of acetate from mole of hexose In most cases using soluble defined substrates, hydrogen production yield and major ... typical Korean food waste and sewage sludge Food waste, sampled from a dining hall, was crushed by an electrical blender under anaerobic condition Sewage sludge was sampled from a local wastewater...
- 11
- 616
- 0
Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx
... s)1, Km of 0.148 ± 0.028 mm and kcat ⁄ Km of 5.2 · 104 m)1Æs)1 toward shikimate, and a kcat of 7.1 ± 0.7 s)1, Km of 0.182 ± 0.027 mm and kcat ⁄ Km of 3.9 · 104 m)1Æs)1 toward NADP Different from ... metabolism of H pylori Recently, the three-dimensional structures of AroE from several bacteria such as E coli, Methanococcus jannaschii, and H influenzae, and YdiB from E coli, including structures of ... discovery of novel SDH inhibitors and further of antimicrobial agents, though few SDH inhibitors have yet been reported so far In this work, we identified a new aroE gene encoding SDH from H pylori...
- 11
- 529
- 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx
... to their positions The arrowheads depict the residues important for the structural core of the IL-10 gene The underlined amino acid residues are the signal sequences of the respective genes The ... conclusion, the IL-10 gene from carp has been isolated and its genomic structure and expression analysis investigated This work will pave the way for further investigation of the biological function of ... Fig Hydropathy plot of putative IL-10 proteins from carp, torafugu and human The x-axis denotes the residue position and the y-axis represents hydrophobicity The hydrophobicity analysis was carried...
- 8
- 584
- 0
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt
... WAVEQMNYILGDNK AWAWALGWDDK GYHENA WPLDYFL TTCTTCAAGGGCTGGCTCCCT CTGATCTAGAGGTACCGGATCC ATCCTCACGAACAAGCAG GATCGCGATGCAGGCCTT GGACGACTACAGCGTCTTCAGTAGA TCCAAACAGTCAGTTTCTTAACCGT Ó FEBS 2003 cDNA ... Double-stranded cDNA was synthesized from the mRNA with a cDNA synthesis kit (TaKaRa, Tokyo, Japan) and used as an abalone cDNA library cDNAs encoding abalone cellulase were amplified by PCR from the cDNA library ... CA, USA) and an ABI 310 DNA sequencer (Applied Biosystems, CA, USA) Results Purification of cellulase from abalone hepatopancreas Hepatopancreas (125 g) dissected from 10 abalones (average shell...
- 8
- 511
- 0
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt
... heptose and the 4¢-phosphate by a galacturonic acid, is biologically, i.e agonistically as well as antagonistically, completely inactive The lack of antagonistic activity may be explained by the fact ... a CaF2 crystal and allowed to stand at room temperature until all free water was evaporated After this, IR spectra were recorded at room temperature and at 37 °C Usually, the original spectra ... immunodeterminant of M fermentans, as anti-(MfGl-II) sera not cross-react with lipid extracts of other Mycoplasma species like Mycoplasia penetrans [8] The comprehensive characterization of MfGl-II from pathogenic...
- 9
- 665
- 1
Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx
... not been functionally proved and the lability of substrate and product rule out any cocrystallization The setting of a helices and b-strands causes very similar CD spectra for this class of enzymes ... mutagenesis MATERIALS AND METHODS Expression vector The FLS cDNA from satsuma mandarin fruits, C unshiu [30], was excised with EcoRI and XhoI from the Bluescript vector (Stratagene) and subcloned in ... major flavonol in satsuma mandarin plants [30] Sequence analysis and mutagenesis The alignment of the polypeptide sequences of 2-oxoglutarate-dependent dioxygenases and related enzymes retrieved from...
- 9
- 864
- 0
Tài liệu Interactions Between Workers and the Technology of Production: Evidence from Professional Baseball doc
... from the author IZA Discussion Paper No 3096 October 2007 ABSTRACT Interactions Between Workers and the Technology of Production: Evidence from Professional Baseball* This paper examines how the ... Interactions Between Workers and the Technology of Production: Evidence from Professional Baseball Eric D Gould Hebrew University and IZA Eyal Winter Hebrew University ... professional baseball that these types of interactions between workers are significant, and appear to be based on a rational response to the technology The Data and Background The data was obtained from the...
- 33
- 436
- 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx
... although, as V volvacea produces at least one other laccase isoform in addition to lac1 [1], this and possibly other laccase isoforms may be contributing to the total laccase activity detected at the ... primers The putative N-glycosylation site is boxed; *; stop codon The putative polyadenylation signals (TATAAA and CATAAA) are in white on a black background Ó FEBS 2003 Laccase gene from Volvariella ... min; then a final extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank...
- 11
- 703
- 0
Báo cáo Y học: Processing, stability, and kinetic parameters of C5a peptidase from Streptococcus pyogenes pptx
... decrease of activity of C5a peptidase at temperatures above 43 °C is associated with the beginning of thermal unfolding Kinetic parameters of C5a peptidase: hydrolysis of peptide and pNA substrates ... available for C5a peptidase from pathogenic Streptococcus pyogenes One of the aims of this study was to map the prosequence region of C5a peptidase and to investigate the mechanism(s) of its maturation ... preparations of wild-type C5a peptidase and S512A mutant consistently displayed truncated and intact NH2-termini, respectively The observed truncation of wild-type C5a peptidase suggested the existence of...
- 13
- 487
- 0
Health Care Quality and Disparities in Women: Selected Findings From the 2010 National Healthcare Quality and Disparities Reports potx
... Citation The 2010 National Healthcare Quality Report and National Healthcare Disparities Report are available online at http://www.ahrq.gov/qual/qrdr10.htm Healthcare Quality and Disparities in Women: ... Healthcare Quality and Disparities in Women: Selected Findings From the 2010 National Healthcare Quality and Disparities Reports Agency for Healthcare Research and Quality, Rockville, MD Pub No 11-0005-1-EF ... themes from the 2010 NHQR and 2010 NHDR emphasize the need to accelerate progress if the Nation is to achieve higher quality and more equitable health care in the near future Health Care Delivery and...
- 6
- 374
- 0
Báo cáo khoa học: Effects of salt on the kinetics and thermodynamic stability of endonuclease I from Vibrio salmonicida and Vibrio cholerae potx
... stoichiometries of participation of water, cations and anions in specific and non-specific binding of lac repressor to DNA Possible thermodynamic origins of the ‘‘glutamate effect’’ on protein–DNA ... function optimally Effects of mutations The point mutations are not in the immediate vicinity of the active site situated at the bottom of the positively charged pocket, but are still likely ... ⁄ Km in the region of 108 s)1Æm)1) shows that the reaction is nearly diffusion controlled, suggesting that the rate-limiting step is either substrate binding or dissociation As all mutations affect...
- 13
- 437
- 0
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt
... PCR and sequencing A QuickPrepÒ Micro mRNA Purification Kit (Amersham Bioscience) was used for isolation of mRNA from P hilaris larval midguts First-strand cDNA synthesis from the isolated mRNA and ... degradation activity of P hilaris cellulase against crystalline cellulose, Avicel (Merck) was used under the same conditions as the CMCase assay Optimal pH for P hilaris cellulase activity against ... N-Terminal amino-acid sequencing analysis indicated that the mature protein of P hilaris cellulase was a truncated form, which lacked a signal peptide composed of the first 21 amino acids Therefore, the...
- 6
- 361
- 0
Từ khóa: t horiuchi t nishimura i 2005 simple and rapid determination of histamine in food using a new histamine dehydrogenase from rhizobium sp anal biochem 15 346 2 pp 320 6potential and environmental concerns of ethanol production from sugarcane molasses in pakistanviscosity dielectric constant dipole moment and surface tension of selected inorganic substancesmeasurements and the determination of the state of a systemreal vs monetary analysis and the determination of the interest ratemuch and maybe most of the money from tax savings and employer matchingdermal absorption of chemical contaminants from soilreserves and the determination of market interest ratesdetermination of fy y from fx xcell growth and neoplastic transformation of cells derived from the telomerase knockout mouse fibroblasts versus embryonic stem cellsstructure and biological activities of glycosaminoglycan analogs from marine invertebrates new therapeutic agentspurification reconstitution and functional characterization of zinc transporter from rat renal brush border membranespresumptive testing and species determination of blood and bloodstainsqualitative and quantitative determination of activitypurification and assays of homodimeric and heterodimeric forms of rnase iii from bacterial extremophiles and mesophilesBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ