0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Characterisation of the rho GTPase target dishevelled associated activator of morphogenesis 1 (DAAM1

Characterisation of the rho GTPase target dishevelled associated activator of morphogenesis 1 (DAAM1

Characterisation of the rho GTPase target dishevelled associated activator of morphogenesis 1 (DAAM1

... 1. 2 .1 Rho GTPase family 10 1. 2.2 Regulation of Rho GTPases .11 1. 2.3 RhoA, Rac1 and Cdc42 13 1. 2.4 Rho GTPases in cell migration 16 1. 3 Dishevelled Associated Activator ... structure of mDia1 N ter and RhoC Figure 1. 4 Dendrogram of Rho GTPase family 10 Figure 1. 5 Regulation of Rho GTPase activity 12 Figure 1. 6 Role of Rho GTPases in cell migration 16 Figure 2 .1 Site ... 1. 1 Formins The focus of this thesis is on Dishevelled Associated Activator of Morphogenesis (DAAM1) , a member of the formin family of proteins The name formin originated from the discovery of...
  • 140
  • 184
  • 0
Báo cáo y học:

Báo cáo y học: "The characterisation of mucin in a mature ovarian teratoma occurring in an eight year old patient

... bilateral ovarian mature teratoma, using both biochemical and histological techniques The Patient Clinical Findings An eight- year- old female presented with a three-week history of abdominal swelling ... high amounts of mucin- like amino acids, serine, threonine and proline Serine and threonine are points of O-glycosylation found in the tandem repeat regions of mucins and their ratios can vary with ... site of secretion and whether the organ is in a normal or diseased state As far as we know this is the first time an amino acid analysis has been done of purified mucin in an ovarian teratoma The...
  • 9
  • 549
  • 0
Báo cáo khoa học: Enzymatic actions of Pasteurella multocida toxin detected by monoclonal antibodies recognizing the deamidated a subunit of the heterotrimeric GTPase Gq potx

Báo cáo khoa học: Enzymatic actions of Pasteurella multocida toxin detected by monoclonal antibodies recognizing the deamidated a subunit of the heterotrimeric GTPase Gq potx

... Kamitani et al Enzymatic actions of P multocida toxin Results Analysis of enzymatic actions of PMT with Gaq Q209E-specific monoclonal antibodies According to a previous study [16], the deamidation ... by the deamidation of Gln205 to Glu by PMT from a cell-based assay and MS [15,16] Gaq was also considered to be deamidated by the toxin The deamidated GTPases were found to lose their GTPase activity ... enzymatic characteristics of PMT have not been analyzed as a result of the lack of an easily-administered assay to detect activity of the toxin In the present study, we developed rat monoclonal antibodies...
  • 11
  • 378
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005" pptx

... propagation of the virus Amino acid comparison of the Leader protease Figure displays the alignment of the deduced amino acid sequence of the first 96 residues of the FMDV Leader protease from the A/IRN/05 ... on the epidemiology of FMDV in Pakistan Open Session of the Research Group of the European Commission for the Control of Foot-and-Mouth Disease (EUFMD) International Control of Foot-and-Mouth Disease: ... Commission for the Control of Foot-and-Mouth Disease (EUFMD): RECOMMENDATIONS of the 73rd session of the executive committee european commission for the control of foot-and-mouth disease (EUFMD)...
  • 12
  • 556
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005" ppt

... propagation of the virus Amino acid comparison of the Leader protease Figure displays the alignment of the deduced amino acid sequence of the first 96 residues of the FMDV Leader protease from the A/IRN/05 ... on the epidemiology of FMDV in Pakistan Open Session of the Research Group of the European Commission for the Control of Foot-and-Mouth Disease (EUFMD) International Control of Foot-and-Mouth Disease: ... Commission for the Control of Foot-and-Mouth Disease (EUFMD): RECOMMENDATIONS of the 73rd session of the executive committee european commission for the control of foot-and-mouth disease (EUFMD)...
  • 12
  • 385
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Respiratory syncytial virus (RSV) attachment and nonstructural proteins modify the type I interferon response associated with suppressor of cytokine signaling (SOCS) proteins and IFN-stimulated gene-15 (ISG15)" potx

... (Figure 1A) This finding is in keeping with the findings of NS1/NS2 antagonism of type I IFNs [4,46,47] and suggests the possibility that type I IFN antagonism is linked to NS1/NS2 induction of ... interfere with direct TLR signaling, but instead regulate paracrine IFN signaling [7] The SOCS protein family is comprised of eight proteins (CIS, cytokine- inducible SH2-containing protein, SOCS17) of ... activate TLRs and retinoic acid inducible gene I (RIG -I) signaling pathways leading to phosphorylation of interferon regulatory factor3 (IRF3) and IRF7 and stimulation of type I interferon (IFN)...
  • 11
  • 435
  • 0
báo cáo hóa học:

báo cáo hóa học:" Expression of interleukin-1 (IL-1) ligands system in the most common endometriosis-associated ovarian cancer subtypes" pdf

... medicine 2008, 5:e232 doi:10.1186/1757-2215-3-3 Cite this article as: Keita et al.: Expression of interleukin-1 (IL-1) ligands system in the most common endometriosis-associated ovarian cancer ... 0.05) The levels of IL-1b in the supernatant of all ovarian cancer cell lines studied were Table Comparative expression of IL-1b and IL-1RA in endometrial cells and epithelial ovarian cancer ... 2) in endometrioid ovarian cancer cell compared to endometrial and ovarian cancer cells This is of further interest given that this subtype of ovarian cancer represents the major and the one of...
  • 8
  • 494
  • 0
Báo cáo y học:

Báo cáo y học: "Phenotypic and functional characterisation of CD4+ memory T cells homing to the joints in juvenile idiopathic arthritis" pps

... study we have investigated the role of CCR7 in the recruitment of CD4+ memory T cells into the inflamed joints of patients with JIA, and attempted the functional and anatomical dissection of these ... degree of disease activity and treatment at the moment of sampling Expression of CCL21 in SF and synovial tissue To gain further insight into the relevance of the interactions between CCR7 and its ... aggregates in the sublining layer or scattered throughout the synovium up to the lining layer [20] Conversely, CCR5-positive cells were detected mainly in the lining layer and in the sublining zone...
  • 12
  • 359
  • 0
Báo cáo y học:

Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

... FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R AATAAAGTGGCAGAGGATACGAGTACT SNP11 FAM-ACGGAAGAAAACATTT-MGB SNP12F AATTGTCTCCCAGTGCATTTTGC SNP12 allele1 VIC-CTGCCAACTCTGGCTG-MGB ... SNP2 allele2 FAM-CACTTATCTGTAGAGCTT-MGB SNP4F CTGGCAATTCTGCCTTGTTTCAG SNP4 allele1VIC- CCGAAGATAAAAGAATC-MGB SNP4R GGATTACAGCCGTGAGCCA SNP4 allele2 FAM- CGAAGATAGAAGAATC-MGB SNP5F AAGCTGAGGCAGGAAGATCAC ... why haplotype S01 of the IL18 gene is skewed in Japanese arthritis patients is due to a basal high frequency of the haplotype S01 in the Japanese population The findings in the present study raise...
  • 9
  • 559
  • 0
Báo cáo y học:

Báo cáo y học: " Characterisation of the immune response to type I collagen in scleroderma" pps

... determined by intracellular (IC) staining of lines PMA (phorbol 12-myristate 13-acetate)/ionomycin activated T cells (a) We detected interferon (IFN)-γ staining but no interleukin (IL)-4 staining ... of a more generalised immune reactivity to extracellular matrix proteins in SSc Laminin and, less often, type IV collagen can induce proliferation of SSc lymphocytes [16] Autoantibodies to fibrillin-1, ... Pathogenic mechanisms in pulmonary fibrosis: collagen- induced migration inhibition factor production and cytotoxicity mediated by lymphocytes J Clin Invest 1976, 58:1223-1232 25 Schrier DJ, Phan...
  • 9
  • 341
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of an altered peptide ligand based on the endogenously presented, rheumatoid arthritis-associated, human cartilage glycoprotein-39(263–275) epitope: an MHC anchor variant peptide for immune modulation" pot

... substitutions may function as partial TCR agonists on the one hand and prevent unwanted immune reactivity on the other [32,33] This approach may thus provide an improved option for APL therapy The ... methods Peptides and altered peptide ligands Peptides were synthesised by solid phase peptide synthesis Purity and identity of the peptides were assessed by reverse phase high performance liquid chromatography ... not shown) In conclusion, the analysis of both the hybridoma panel and the polyclonal T cell response to the 263–275 epitope has led to the identification of MHC binding and TCR contact residues...
  • 11
  • 314
  • 0
Báo cáo y học:

Báo cáo y học: "Characterisation of the cannabinoid receptor system in synovial tissue and fluid in patients with osteoarthritis and rheumatoid arthritis" pdf

... from synovia from OA and RA patients Discussion The novel finding of the present study is the identification of the key components of the cannabinoid receptor system in the knee synovia of patients ... levels of PEA were similar in the synovial fluid of OA and RA patients Thus, levels in the synovial fluid not simply reflect the level of synthesis/release and catabolism of endocannabinoids and ... summary, cannabinoid CB1 and CB2 receptor protein and RNA and the endocannabinoids AEA and 2-AG are present in the synovia of patients with end-stage OA and RA The presence of increased levels of...
  • 14
  • 500
  • 0
Báo cáo y học:

Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx

... this article as: Sekino et al.: Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports Journal of Medical Case Reports ... Peutz-Jeghers type hamartomatous polyp Case was a hamartomatous polyp with a focus of well-differentiated adenocarcinoma, and Case was a hamartomatous polyp with Table Twenty-seven cases of solitary duodenal ... Peutz JLA: Very remarkable case of familial case of polyposis of mucous membrane of intestinal tract and nasopharynx accompanied by peculiar pigmentations of skin and mucous membrane Ned Maandschr...
  • 4
  • 458
  • 0
báo cáo khoa học:

báo cáo khoa học: " Characterisation of the legume SERK-NIK gene superfamily including splice variants: Implications for development and defence" ppt

... doi:10.1186/1471-2229-11-44 Cite this article as: Nolan et al.: Characterisation of the legume SERK-NIK gene superfamily including splice variants: Implications for development and defence BMC Plant Biology 2011 11:44 ... All of the M truncatula sequences contain predicted transmembrane and kinase domains The genomic structure of each of the M truncatula SERK and SERKL genes and the relative positions of the SERK ... exon encoding the equivalent of exons 9, 10 and 11 in the other genes The boundaries of greatest divergence occur between exons 6/7 and 7/8 Exons 6, and encode LRR5, the SPP and the transmembrane...
  • 16
  • 486
  • 0
báo cáo khoa học:

báo cáo khoa học: " Characterisation of the tryptophan synthase alpha subunit in maize" pptx

... Site-specific mutagenesis of the alpha subunit of tryptophan synthase from Salmonella typhimurium Changing arginine 179 to leucine alters the reciprocal transmission of substrateinduced conformational ... scheme of the tryptophan synthase reaction General General scheme of the tryptophan synthase reaction Indole, which is formed from IGP by the α-subunits is channelled to β-subunits, which synthesize ... Frey M, Gierl A, Niks D, Dunn MF, Schlichting I: On the structural basis of the catalytic mechanism and the regulation of the alpha subunit of tryptophan synthase from Salmonella typhimurium and...
  • 11
  • 416
  • 0

Xem thêm

Từ khóa: characterisation of the xylem of 352 coniferswhich of the following is most likely associated with fair weathergeneral characteristics of the rab gtpase subfamilysự tích đức phật 1 the life of buddha 1what is the order of reactivity of group 1 elementswhat is the trend in reactivity of group 1 elementswhat is the reactivity of group 1 elementsfce use of english 1 for the revised cambridge examination pdfif you flip a coin 3 times what is the probability of getting 1 headswhat is the data protocol unit of layer 1star ocean till the end of time book of prophecies 1pirates of the caribbean 4 on stranger tides full movie part 1the 15 of tier 1 limit on innovative instruments3d deviation maps from geomagic® of the left ilium of gpit 1 plateosaurus engelhardti maximum extension 426 mm 1 pointcloud based file compared to unedited ct file 2 pointcloud based file compared to ct file in which all major crac3d deviation maps from geomagic® of the left humerus of gpit 1 plateosaurus engelhardti length 351 mm 1 pointcloud based file compared to ct file 2 nurbs file compared to ct fileBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ