Development of a new elastic path controller for the collaborative wheelchair assistant
Development of a new elastic path controller for the collaborative wheelchair assistant
... providing a guide path and that the driving performance of the elastic mode NATIONAL UNIVERSITY OF SINGAPORE SINGAPORE SUMMARY viii is comparable to that of the constrained mode The drawback of the ... Research Objectives The primary objective of the present study was to develop a new Elastic Path Controller for the Collaborative Wheelchair Assistant, to handle the singularity issues, and to make ... approaches, and (2) path control approaches for robotic wheelchairs 2.1 Path planning approaches Given the geometry information of the robot and environmental obstacles, the task of robot path planning...
- 160
- 310
- 0
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx
... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription, ... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples ... 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3' 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3'...
- 12
- 509
- 0
báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot
... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples ... 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3' 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription,...
- 12
- 471
- 0
Development of a fluorescence correlation spectroscopy method for the study of biomolecular interactions
... products labeled with the same fluorescent dye, the only way of differentiating the product from the reactant is when the product has a molecular mass that differs from the reactants by at least a factor ... of the dual-color complexes formed This easily distinguishes the products from the free reactants via the amplitude of the CCF, as compared to the weak dependence of the ACF with the mass of the ... (2.40) For fittings of cross -correlation amplitudes (in chapters 3—5), the software package Mathematica 5.0 (Wolfram Research Inc., Champaign, IL) was used to model the changes of CCF amplitudes...
- 162
- 393
- 0
Development of an elastic path controller for collaborative robot
... the desired path for collaborative robots The kinematics and the elastic path planners for the CWA and Scooter cobot are described in chapters and Simulation of the elastic path controller are ... 3.3 21 21 Elastic Factor as a function of the elastic force and distance to the guiding path 22 3.4 Block diagram of Elastic path controller for Collaborative ... guiding path in guided mode as the elastic path controller is reduced to a path following controller when no elasticity is used 24 Figure 3.4 Block diagram of Elastic path controller for Collaborative...
- 81
- 303
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis of ... Heart Yolk sac Brain Embryo A chemistry using antibodies against the pan-EC marker, CD31, the lymphatic endothelial and liver sinusoidal endothelial marker Lyve-1 (lymphatic vessel endothelial...
- 11
- 873
- 0
Báo cáo y học: " Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" pot
... 5’-GCCAAAATTCGCAGTCCC-3’, 0.5 μM primer hbv460 (antisense) 5’-GATAGTCCAGAAGAACCAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and Dabcyl at the ... RTQ -PCR assay These findings suggest that the ultra sensitive RTQ -PCR assay is equally reliable as the Figure Comparison of the HBV-DNA values estimated using COBAS TaqMan Test and ultra- sensitive ... with the ultra sensitive RTQ -PCR against the WHO 1st International Standard for HBV-DNA The calibration of the in-house assay was done against the WHO st International Standard for HBV-DNA (OptiQuant®...
- 6
- 536
- 1
Hyperscsi design and development of a new protocol for storage networking
... connection and data reliability mechanism A UDP datagram has a header and a payload The application data is carried as payload and the header carries the necessary information for protocol operation A ... volume of and the increasingly critical role played by data storage, there is a strong demand to put data storage on network Therefore, how to share data, improve data reliability, and back up and ... parameter to determine the total data transfer rate and packet loss ratio RBUDP separates the signaling control and data communication channel to achieve higher data transfer rate The analytical...
- 169
- 515
- 0
báo cáo hóa học:" Development of a patient reported outcome measure for fatigue in Motor Neurone Disease: The Neurological Fatigue Index (NFI-MND)." pot
... dyspnoea or sleepiness [2] The lack of research relating to fatigue in this population may be due in part to lack of tools available to accurately measure the experience of fatigue in MND There are ... Summary Analysis figures for Rasch analyses of the NFI:MND Item Residual Analysis Name 1.Energy Initial Energy Final Weakness Initial Weakness Final Summary Initial Summary Final Ideal Values # of ... feelings of fatigue As such 16 the NFI-MND fatigue scale may serve as a valuable tool for assessing the patient experience of fatigue and how this disabling symptom changes over time in clinical...
- 31
- 318
- 0
Báo cáo khoa học nông nghiệp " Classical Swine Fever (CSF): Development of a new classical swine fever vaccine - Milestone 7" pot
... Team Leader: Dr Tran Xuan Hanh Australian Organisation: Australian Personnel: Australian Animal Health Laboratory (AAHL), PMB 24, Geelong, VIC 3220, Australia Mr Chris Morrissy Date commenced: 01/03/2008 ... culture propagated vaccine CSF vaccine to allow the production of a cheap and high quality vaccine To enhance the diagnostic capability of Vietnamese laboratories to facilitate the control of CSF ... TCID50/ml following passage to a plateau of around 106.33 TCID50/ml at passage 12 as shown in Attachment • Characterisation of c-strain CSF vaccine virus Following successful adaptation and subsequent...
- 10
- 426
- 0
Báo cáo hóa học: " Design and Realization of a New Signal Security System for Multimedia Data Transmission" ppt
... This data- processing rate is fast enough for realtime data protection in multimedia data transmission applications The proposed signal security system is suitable for both software and hardware ... updating period of the parameters of µ and x(0) could be based on the basic unit of video frame or audio frame in representing the multimedia data A New Signal Security System for Multimedia Data ... the silicon area normalized to a 0.35 µm NArea = DRPA = Area (Technology/0.35)2 Data − rate NArea Mbps/mm2 (20) (21) A New Signal Security System for Multimedia Data Transmission ctrl vo 1301...
- 15
- 421
- 0
Báo cáo khoa học: "Development of a new branchiness index ASIX – A simple tool to describe branchiness in young deciduous forest stand" pps
... development of ASIX had not the aim to create another architectural model The ASIX values are proposed as an additional, very easy, tool to describe and compare tree quality The periodical comparison of ... is affected less by a branch of equal thickness, the growth potential has to be integrated in the model to describe the effect of branchiness on tree quality The branchiness index (ASIX) was accordingly ... will disappear in the stand’s future life The estimation of branchiness and its effect in later ages is difficult In the literature one can find a large amount of models dealing with branchiness...
- 8
- 315
- 1
báo cáo khoa học: " Implementation of a new cost efficacy method for blood irradiation using a non dedicated device" pptx
... computed and a comparison of the two procedures has been carried out Design of a blood irradiation container and set-up To facilitate and standardize the blood component irradiation using a linear accelerator, ... experience of IRE in the implementation of an internal blood irradiation program using a conventional linear accelerator (LINAC), as an alternative to out-source services The secondary aim is to compare ... acceptance and the irradiation duration (mean 2.5 h) This procedure requires the availability of a car, a driver and an operator of the centre of Transfusion Department to deliver the irradiated...
- 6
- 291
- 0
báo cáo khoa học:" Development of a patient reported outcome scale for fatigue in multiple sclerosis: The Neurological Fatigue Index (NFI-MS)" pptx
... phase of measurement, with the aim of developing a valid and reliable patient reported outcome scale for fatigue, the Neurological Fatigue Index (NFIMS) The items in the scale are based on the ... the notion that the sub-dimensions were part of a single, supraordinate theme of neurological fatigue Fit of scale data to the Rasch model also allows for a transformation of the ordinal raw ... Trust, for allowing the approach of patients under their care; and Dave Watling and the staff of the Clinical Trials Unit, WCNN for their assistance with the mailout Author details The Walton...
- 10
- 356
- 0
Từ khóa: development of a cation exchange purification step for an fc fusion proteindevelopment of a transmmision hand held meter for assessing chlorophyll and nitrogen in fresh leavesdevelopment of a terrestrial index of ecological integrity tiei a new tool for ecosystem managementdevelopment of a digital imaging system for objective measurement of hyperpigmented spots on the faceconceptual basis of a new scientific approach for understanding viral emergencedevelopment of a database for lake ecosystem studies linking gis with rdbmsthe knight of a new crusadefurther development of a secured unifieddevelopment of a spoken languageintroduction of a new paraphrase generation tooltemporal information processing of a new languagedevelopment of a recipe management systemthe design and development of a solar powered refrigeratorwhat is the role of mass communication in the development of a countrya new dataset and method for automatically grading esl textsBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam