Development of a bioresorbable bone graft alternative for bone engineering applications

... S, Bai HF, Gajadar B, Mia W, Amber S, Monica S, iv Sambit S, Amit K, Radek and Joanna, Sang Joon A, Tarik A, Anand L, staff of Bioengineering, Orthopaedic Surgery, DES SGH and NUSTEP For all ... sectioned and sawed through the implantation site for gross examination and biocage material retrieval Image shows all sample groups at months (A) Autograft: uniform bone trabeculae observed at the ... the haphazard organisation of the collagen fibers and is mechanically weak Lamellar bone is more precisely, highly oriented and gradually laid down, it is characterised by a regular parallel alignment...

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... Risk Management Framework  Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Management capabilities and approaches  APEC and the ... identified in APEC Management Framework - Introd uced Marine Pests Considerations for a risk management framework  Risk management - “ culture, processes and structures that are directed towards the...

Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription, ... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples ... 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3' 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3'...

báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot

... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples ... 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3' 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription,...

báo cáo hóa học:" Development of a patient reported outcome measure for fatigue in Motor Neurone Disease: The Neurological Fatigue Index (NFI-MND)." pot

... dyspnoea or sleepiness [2] The lack of research relating to fatigue in this population may be due in part to lack of tools available to accurately measure the experience of fatigue in MND There are ... Summary Analysis figures for Rasch analyses of the NFI:MND Item Residual Analysis Name 1.Energy Initial Energy Final Weakness Initial Weakness Final Summary Initial Summary Final Ideal Values # of ... feelings of fatigue As such 16 the NFI-MND fatigue scale may serve as a valuable tool for assessing the patient experience of fatigue and how this disabling symptom changes over time in clinical...

báo cáo khoa học:" Development of a patient reported outcome scale for fatigue in multiple sclerosis: The Neurological Fatigue Index (NFI-MS)" pptx

... phase of measurement, with the aim of developing a valid and reliable patient reported outcome scale for fatigue, the Neurological Fatigue Index (NFIMS) The items in the scale are based on the ... the notion that the sub-dimensions were part of a single, supraordinate theme of neurological fatigue Fit of scale data to the Rasch model also allows for a transformation of the ordinal raw ... Trust, for allowing the approach of patients under their care; and Dave Watling and the staff of the Clinical Trials Unit, WCNN for their assistance with the mailout Author details The Walton...

Development of a new elastic path controller for the collaborative wheelchair assistant

... providing a guide path and that the driving performance of the elastic mode NATIONAL UNIVERSITY OF SINGAPORE SINGAPORE SUMMARY viii is comparable to that of the constrained mode The drawback of the ... Research Objectives The primary objective of the present study was to develop a new Elastic Path Controller for the Collaborative Wheelchair Assistant, to handle the singularity issues, and to make ... approaches, and (2) path control approaches for robotic wheelchairs 2.1 Path planning approaches Given the geometry information of the robot and environmental obstacles, the task of robot path planning...

Development of a fluorescence correlation spectroscopy method for the study of biomolecular interactions

... products labeled with the same fluorescent dye, the only way of differentiating the product from the reactant is when the product has a molecular mass that differs from the reactants by at least a factor ... of the dual-color complexes formed This easily distinguishes the products from the free reactants via the amplitude of the CCF, as compared to the weak dependence of the ACF with the mass of the ... (2.40) For fittings of cross -correlation amplitudes (in chapters 3—5), the software package Mathematica 5.0 (Wolfram Research Inc., Champaign, IL) was used to model the changes of CCF amplitudes...

Development of a generic three dimensional model for stratified flows

... flows Although two -dimensional models are Chapter computationally efficient and their results are generally reasonable, most practical applications generally require a full three- dimensional analysis ... Reynolds Averaged Navier-Stokes Equations The time averaged form of the Navier-Stokes equations are called the Reynolds Averaged 12 Chapter Navier-Stokes (RANS) equations These models calculate a mean, ... turbulent part can be very large and of the same order as the mean Examples are unsteady flow in general, wake flows or flows with large separation For this type of flows, it is more appropriate to...

Identifcation and stablization of a novel 3d hepatocyte monolayer for hepatocyte based applications

... 2.3.1 Fabrication and characterization of PET film grafted with poly-acrylic acid 49 2.3.2 Fabrication and characterization of bioactive substrata 51 2.3.3 Enhancement of hepatocyte attachment ... LIST OF SYMBOLS 3-MC 3-methylcholanthrene AHG 1-O-(6’-aminohexyl)-D-galactopyranoside AMC Academic Medical Center ALF Acute liver failure ALT Alanine Transaminase APAP Acetaminophen ASGPR Asialoglycoprotein ... (especially the P450 metabolic enzymes), and the requirement of relatively low amount of test materials The disadvantages of hepatocytes -based screening are the lack of host factors and the lack of...

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse pdf

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis of ... Heart Yolk sac Brain Embryo A chemistry using antibodies against the pan-EC marker, CD31, the lymphatic endothelial and liver sinusoidal endothelial marker Lyve-1 (lymphatic vessel endothelial...

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢);...

Báo cáo "Development of a software package for 3D structured mesh generation " pdf

... the software package interface Fig The flowchart of the program for 3D structured elliptic mesh generation Results The software package developed has been tested and applied to the mesh generation ... input data and the output meshes The software package has been initially used as a tool for 3D structured mesh generation for simulations of compressible turbulent atmospheric flows and air quality ... simulations 4.1 The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any 3D...

Development of a DTPA soil test for zinc, iron, manganese, and cropper

...

Báo cáo khoa học: Identiﬁcation of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efﬁciently detect cross-linking enzyme activity in the skin pot

... sequence for transglutaminase J Biotechnol 13 1, 12 1 12 7 36 Tarcsa E, Candi E, Kartasova T, Idler WW, Marekov LN & Steinert PM (19 98) Structural and transglutaminase substrate properties of the small ... whereas there was a significant increase in incorporation in the presence of TGase pepK5QN also failed to react with casein in the presence of TGase (data not shown) These results indicate that the ... or in the presence of EDTA, which indicated that the cross-linking reaction was catalyzed specifically by TGase To further evaluate the specificity of the assay for TGase 1, skin sections from a...

Xem thêm

Từ khóa: development of a cation exchange purification step for an fc fusion protein development of a transmmision hand held meter for assessing chlorophyll and nitrogen in fresh leaves development of a digital imaging system for objective measurement of hyperpigmented spots on the face development of a terrestrial index of ecological integrity tiei a new tool for ecosystem management development of a simple model for vaccination against haemonchus development of a stress insensitive mgcuzn nicuzn composite ferrite useful for microinductors ap development of a rapid screening procedure for growth and lipid content of microalgae development of a genetic transformation system for microalgae development of a framework for developmental immunotoxicity dit testing development of a database for lake ecosystem studies linking gis with rdbms further development of a secured unified development of a spoken language development of a recipe management system the design and development of a solar powered refrigerator what is the role of mass communication in the development of a country Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ