Ageing well studies of its global and multidomain and construct among multi ethnic singaporean seniors
Ageing well studies of its global and multidomain and construct among multi ethnic singaporean seniors
... Fast ageing population and its impact 1.2 Singapore and successful ageing 1.3 History on the construct of successful ageing 1.4 Multidimensional construct of successful ageing 1.5 Global construct ... multidimensional and global constructs of successful ageing among community-dwelling older adults aged 65 and above Although it is predicted that both multidimensional and global constructs of ... of successful ageing 1.6 Measurement: Multidimensional construct of successful ageing 1.7 Measurement: Global construct of successful ageing 1.8 Ethnic and cultural dimensions in successful ageing...
- 295
- 130
- 0
Studies of vortex breakdown and its stability in a confined cylindrical container 1
... RECONMMENDATIONS 15 7 PUBLICATIONS 15 9 ACHIEVEMENT 16 1 REFERENCES 16 2 iv SUMMARY A combined experimental and numerical study on vortex breakdown structure and its dynamic behavior in a confined cylindrical ... LC1 state at Re = 2760 and Λ = 1. 704, and (b) an LC2 state at Re = 2750 and Λ = 1. 780, (each state is asymptotically stable) 81 xii Fig 5 .12 Variation of ΔE0 with Re for (a) LC1 and (b) LC2, at ... for vortex breakdown, and the concave shape of the streamsurfaces of a confined swirling flow may be considered as an additional characteristic of vortex breakdown They argued that the swirling...
- 43
- 213
- 0
Studies of vortex breakdown and its stability in a confined cylindrical container 2
... the analysis of the flow dynamics, as well as allowing still image to be captured via a frame grabber card in a PC For some cases, a high resolution still digital camera was also used to obtain ... the data was sampled and acquired over about 20 minutes, Re is nominally constant For those cases with fixed Reynolds number and varying Λ, rotation rate of the top disk was re-adjusted to account ... disk has a maximum excursion of 0.040 mm (about 0.03º) and a nominal gap of 0.40 mm between the rotating plate and the cylinder The disk was driven by a microstepper motor operating at 20 ,000...
- 11
- 208
- 0
Studies of vortex breakdown and its stability in a confined cylindrical container 3
... experimental results Table presents the values and locations of three local maxima and minima of ψ and η at H/R = 2.5 and Re = 2494 with constant rotating speed The finite differential results ... rotating end 34 CHAPTER NUMERICAL SIMULATION METHOD Two kinds of rotating motions were considered: a constant rotation only and a constant rotation with a superimposed sinusoidal modulation In all ... is adopted, with the origin at the centre of the rotating end wall and the positive-z axis pointing towards the stationary endwall R H z Ω θ r Fig 3. 1 Flow configuration in a confined cylinder...
- 16
- 268
- 0
Studies of vortex breakdown and its stability in a confined cylindrical container 4
... in a low aspect ratio container? This part of the investigation aims to see if an S-shape vortex structure or a spiraltype vortex breakdown can be also produced in a low aspect ratio container ... vortex breakdown, with the upstream and smaller bubble eventually disappears In contrast, the shrinking downstream bubble resulted in the formation of a helical instability of increasing wavelength ... R of 87.25 mm, and a matching rotating disk at the top and a stationary disk at the bottom of the cylinder The height H of the flow domain, and the aspect ratio Λ = H/R, can be varied by moving...
- 19
- 211
- 0
Studies of vortex breakdown and its stability in a confined cylindrical container 5
... visualization can capture the oscillating frequency of the flow as shown above, hot-film was chosen in the following study as it has an added advantage, particularly in the vicinity of Hopf and ... bifurcations, the same strategy as in the numerical work of Marques et al (2002) was adopted in this study, i.e., once a desired state was obtained at a particular point in (Λ, Re) parameter space, ... Fig 5. 30 Hot-film data (time series over minute and corresponding the amplitude of the FFT results) taken at times as indicated, starting with an LC1 state at Re = 2700 and Λ = 1. 757 and increased...
- 37
- 218
- 0
Studies of vortex breakdown and its stability in a confined cylindrical container 6
... spatial discretization, utilizing a Galerkin-Fourier expansion in the azimuthal coordinate θ and Chebyshev collocation in r and z The radial dependence of the variables is approximated by a Chebyshev ... equations (Mercader, Net and Falqués 1991) In this study, the aspect ratio Λ was fixed at 2.5 and variations in Re, A and ωf were considered 96 spectral modes in z, 64 in r, and up to 24 in θ ... QUENCHING OF UNSTEADY VORTEX BREAKDOWN Fig 6. 12 Phase portraits (with Wa and Ww as the horizontal and vertical axes, respectively) at Re = 2800, Λ = 2.5, ωf = 0.5 (ωf /ω0 ≈ 2.88) and A as indicated...
- 31
- 291
- 0
Studies of vortex breakdown and its stability in a confined cylindrical container 7
... was set at 2600 and below with the modulation amplitude A varying from 0.005 to 0.04, and the aspect ratio Λ was maintained at a constant value of 2.5 throughout Note that all flow visualization ... bifurcation is at Re = 271 0, and the second and third occur at Re = 3044 and 3122 Of course, the Hopf frequencies vary with parameters (Re and Λ, as well as A and ωf), but these variations are ... essentially steady, with the streamlines virtually identical to those of the A = steady state shown in Fig 7. 1, and all the oscillations are concentrated in the bottom and sidewall boundary layers...
- 16
- 225
- 0
Studies of vortex breakdown and its stability in a confined cylindrical container 8
... useful in applications where unsteady vortex breakdown is prevalent, such as the tail buffeting problem 156 CHAPTER CONCLUSIONS AND RECOMMENDATIONS 8. 2 Recommendations A confined cylindrical container ... Mechanics, Vol 599, No 3, pp441-464, 20 08 Y.D Cui, T.T Lim and H.M Tsai, “Blowing and suction effects on vortex breakdown in an enclosed cylindrical container , Paper AIAA 2007-4360, 37th AIAA ... (forcing) stabilize the flow or not 1 58 PUBLICATIONS LIST OF RELATED PUBLICATIONS T.T Lim and Y.D Cui, “On the generation of a spiral-type vortex breakdown in an enclosed cylindrical container ,...
- 10
- 238
- 0
Tài liệu Euphorion Being Studies of the Antique and the Mediaeval in the Renaissance - Vol. II pot
... imagine the old knight, only half aware of the sunshine of the evening, the noise of the streets, the looks of the crowd, the great minster rising half-finished in the midst of the town by the ... and daughters -in- law, forming a hierarchy attending to the business of factory or counting-house under the orders of the father of the family, and to the economy of the house-under the superintendence ... joyous orange against the greenness of the hill Such spots there are and many in the winter of the Middle Ages; though it is not in them, but where the rain beats, and the snow and the wind tugs, that...
- 71
- 630
- 0
Tài liệu Báo cáo khoa học: "Predicting the fluency of text with shallow structural features: case studies of machine translation and human-written text" doc
... understand which factors are predictive of good fluency The distribution of fluency scores in the dataset is rather skewed, with the majority of the sentences rated as being of average fluency as ... assess the content of the sentence compared to a human gold-standard Yet, the assessments of the two aspects were often the same—readability /fluency of the sentence is important for understanding the ... from machine translations • Distinguish human and machine translations • Distinguish fluent machine translations from poor machine translations • Distinguish the better (in terms of fluency) translation...
- 9
- 438
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag ... template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ ... shielded from trypsin digestion on the cis-side of the membrane The A B 4004 Fig Determination of the topology of PSI -G in the thylakoid membrane using in vitro import experiments (A) Insertion...
- 9
- 422
- 0
Báo cáo khoa học: Structural studies of nucleoside analog and feedback inhibitor binding to Drosophila melanogaster multisubstrate deoxyribonucleoside kinase doc
... structure of dNK has previously been determined in complexes with substrates and a feedback inhibitor [12,13] It has a structure similar to that of the human dGK and dCK and belongs to a structural ... specificity of dNK Earlier crystallographic studies of substrates dT and dC and on the structure of the feedback inhibitor complex with dTTP, as well as mutation studies, have established some of the ... positioned to form specific interactions to the sugar and the base of the substrate The 3¢-oxygen of deoxyribose is hydrogen bonded to Tyr70 and Glu172, and the 5¢-oxygen is hydrogen bonded to Glu52 and...
- 10
- 308
- 0
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc
... DUA (C) C1 C2 C3 C4 C5 C6 C1 C2 C3 C4 C5 C6 CH3 C¼O C1 C2 C3 C4 C5 10 2.83 71. 54 67. 51 109. 41 147. 01 – 10 2.97 55.02 78.24 79.04 77. 41 63. 91 25.27 17 7.79 65. 61 74.58 73.04 82.89 76 .11 10 4.25 72.60 ... oligosaccharides from the chondroitin sulfates 1H-NMR and 13 C-NMR studies of reduced disaccharides and tetrasaccharides Eur J Biochem 268, 11 81 11 89 Bayliss MT, Osborne D, Woodhouse S & Davidson C (19 99) Sulfation ... three species of molluscs J Biol Chem 259, 14 31 14 35 12 Oliveira FW, Chavante SF, Santos EA, Dietrich CP & Nader HB (19 94) Appearance and fate of a beta- 13 14 15 16 17 18 19 20 21 22 23 galactanase,...
- 11
- 481
- 0
Báo cáo khoa học: Antimicrobial and conformational studies of the active and inactive analogues of the protegrin-1 peptide docx
... activity of the peptides A better understanding of the mode of action of these peptides is crucial for the development of a new generation of antibiotics It is known that, in the absence of both ... at the two spatial tips of the molecule, at the N-terminus with Arg1 and in the turn in the presence of Arg7 and Arg9 (see Figs and 4) The shorter analogue, BM-2, was the most flexible of all the ... mechanistic step in the killing of bacteria [16,20] The conformations of the structural features determining the antimicrobial activity of protegrins Conformational studies of protegrin-1 analogues were...
- 13
- 427
- 0
Từ khóa: x ray diffraction studies of chitin chitosan and their derivativesex vivo multinuclear nmr spectroscopy of perfused respiring rat brain slices model studies of hypoxia ischemia and excitotoxicity quotsarnat s growth studies of the orbit and upper facemethods available for studies of cftr folding and correctionstudies of drug resistance and the dynamic behavior of hiv 1 protease through molecular dynamics simulationsstudies of transgenic mice and of human genetic matrix diseasesin vitro toxicological studies of their biotransformation and potential negative effects3 human studies of maternal nutrition and induced epigenetic changestudies of the dispersed and continuous phasein vitro studies of cell proliferation and cell deathcooperating in preparing analyses and follow up studies of chemical accidents and proposing improvementsb— human studies of gallbladder dysmotility and gallstone pathogenesiscontrol and cross sectional studies of vitamin d and type 2 diabetesclinical animal and epidemiologic studies of vitamin d and rheumatoid arthritismolecular dynamics simulation studies of coupled protein and water dynamicsBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam