0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process

Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process

Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process

... how SEA may be applied to compare different energy scenarios and how, by incorporating the wider impacts considered during the SEA process, a more sustainable power plan can be developed It also ... leads to lower demand and reduces the need to build more power plants of all types Although still substantial, the financial costs and the environmental and social impacts that have to be managed ... lignite and coal capacity under the global impacts case and of GW of large hydropower capacity (22 plants), GW of nuclear capacity, and GW of lignite and coal capacity under the regional impacts case...
  • 50
  • 456
  • 0
 Báo cáo y học:

Báo cáo y học: "The association of meat intake and the risk of type 2 diabetes may be modified by body weight"

... consumption and risk of diabetes or of interactions between poultry consumption and BMI and the risk of type DM Red meat consumption was associated with a modest increase in the risk of type DM in the ... and type DM may also reflect other unidentified factors It may be possible that consumption of red meat and processed meat may not increase the risk of type DM, per se, but be part of a dietary ... patterns and the incidence of type diabetes Am J Epidemiol 20 05; 161(3) :21 9 -22 7 Tables Table 1: Total meat* , red meat, poultry and processed meat intake by socio-demographic factors and other participant...
  • 8
  • 701
  • 0
Báo cáo khoa học: ADPase activity of recombinantly expressed thermotolerant ATPases may be caused by ppt

Báo cáo khoa học: ADPase activity of recombinantly expressed thermotolerant ATPases may be caused by ppt

... of NtrC1 ATPase The presence of trace quantities of AK thus caused the apparent ADP hydrolysis, by generating ATP to be used by the ATPase Discussion It is widely known that proteins cannot be ... the other of which was enriched for ADPase activity Despite the fact that the above results were consistent with NtrC1 ATPase being able to hydrolyze ADP, the ADPase activity could not be visualized ... apparent ADPase activity We searched for differences between the Q-fraction and S-fraction that could shed light on the source of the apparent ADPase activity No differences were observed by staining...
  • 9
  • 401
  • 0
Báo cáo y học:

Báo cáo y học: " Quantitative PCR used to Assess HIV-1 Integration and 2-LTR Circle Formation in Human Macrophages" potx

... PBLs and HIV-1 integration was measured by two-step quantitative PCR, and (C) 2-LTR circle formation was measured by real-time PCR (**p < 0.01) HIV-1 Integration in human macrophages Human monocyte-derived ... of HIV-1 infection include viral entry by binding to the main receptor CD4 and either of two coreceptors CCR5 or CXCR4 Upon membrane fusion, the viral core is released into the cytoplasm Once inside ... strains By using these primary cell subsets, we show that this method can be useful in precisely monitoring the level of integration in laboratory settings and perhaps in HIV-infected patients to conclusively...
  • 6
  • 370
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx

... Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC Common CCAGCTTTCTCCTTCTGTCCCATAA Table Demographics and asymmetrical dimethyl arginine (ADMA) ... Table Table Correlation matrix of asymmetrical dimethyl arginine (ADMA) and inflammatory markers Variation in asymmetrical dimethyl arginine (ADMA) levels with carriage of specific alleles at ... counts with percentages in parenthesis or as medians with interquartile ranges in parenthesis IL6 was measured in pg/ml, asymmetrical dimethyl arginine (ADMA) in µmol/l, lactate in mmol/l, and mean...
  • 7
  • 265
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot

... Genetic Vaccines and Therapy 2005, 3:5 Background Lung cancer is a leading cause of cancer death in Australia and the world [1,2] There are two types of lung cancers, non small cell (NSCLC) and ... were as follows: EGFR gene forward primer, 5' -CGAGGGCAAATACAGCTTTG -3'; backward primer, 5'- CCTTCGCACTTCTTACACTTG -3'; probe 5'FAM-ACGCCGTCTTCCTCCATCTCATA GCTAMRA3' Thermal cycler parameters ... it has recently emerged as an innovative target for the development of new cancer therapy, particularly for NSCLC [10] Recently, a monoclonal antibody against EGFR called cetuximab has been developed...
  • 12
  • 314
  • 0
Prospects of concentrating solar power to deliver key energy services in a developing country

Prospects of concentrating solar power to deliver key energy services in a developing country

... to south: I: Tarapaca, II: Antofagasta, III: Atacama, IV: Coquimbo, V: Valparaiso, RM: Region Metropolitana, VI: Libertador General Bernardo O’Higgins, VII: Maule, VIII: Biobio, IX: Araucania, ... potential for satisfying other demands as well, such as processing heat for industry, co-generating of heating, cooling and power, water desalination, household cooking and small-scale manufacturing ... concentration impedes new stakeholder entry • Failure to incorporate external factors and other impacts • Access to financing • Lack of knowledge and capacitated human capital • Bad coordination...
  • 12
  • 491
  • 0
Evaluate and compare different organizational structures and culture

Evaluate and compare different organizational structures and culture

... site: http://www.microsoft.com/presspass/exec.mspx?pf=true II Detail: Evaluate and compare different organizational structures and culture: Getting the structure right is important for any organization, ... Problems and Practice Paul Chapman Veeramuthu (2008) Organizations and Behavior, Hanoi: National Economic University 2- page handout on the Organizational Structure and Culture 3 Figure 1.1 Organizational ... clearly and effectively Organizational culture is also remarkable As the same as other concepts, there are many way to define organizational culture One of the definition is described as follow: “Culture...
  • 20
  • 368
  • 0
“ A Powerful Collection of Sales Techniques to Help You Overcome Objections and Close More Sales Than Ever Before! ” doc

A Powerful Collection of Sales Techniques to Help You Overcome Objections and Close More Sales Than Ever Before! ” doc

... to make your first training appointment today or would tomorrow be better for you? “Were you going to work out today ?” “What other errands you have to run today ?” “Did you want to go ahead and ... early rather than too seldom and too late! You need to take advantage of any opportunity you have to gain commitment from your guest You not want to let the opportunity to close a sale pass you ... last month If I can get you a guarantee like this, will you get started ?” Or, “We had a split-pay option available last year that is a way to pay your membership off early, and at a discount It’s...
  • 24
  • 529
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Algorithms of Common Solutions to Generalized Mixed Equilibrium Problems and a System of Quasivariational Inclusions for Two Difference Nonlinear Operators in Banach Spaces" pdf

... Motivated by the work of Combettes and Hirstoaga 34 in a Hilbert space and Takahashi and Zembayashi 33 in a Banach space, Zhang 35 and also authors of 36 obtained the following lemma Lemma 2.2 see 35 ... Saewan and P Kumam, A hybrid iterative scheme for a maximal monotone operator and two countable families of relatively quasi-nonexpansive mappings for generalized mixed equilibrium and variational ... 23 31 X Qin, S S Chang, Y J Cho, and S M Kang, “Approximation of solutions to a system of variational inclusions in Banach spaces,” Journal of Inequalities and Applications, vol 2010, Article...
  • 23
  • 399
  • 0
How to Beat the Energy Thieves And Make Your Life Better Emotions doc

How to Beat the Energy Thieves And Make Your Life Better Emotions doc

... so they can divert you from your true path and destroy your life and your existence… How to Beat The Energy Thieves And Make Your Life Better! Emotions Energy Thieves Within Your Emotions Energy ... Emotions How to Stop Emotions Damaging Your Energy and Your Life Fear, Loneliness, Anger, Hatred, Envy, Greed, Lying, Selfishness, Arguing, Stress, etc How to Beat the Energy Thieves And Make ... Guarantee they’ll make you feel better In reality their only intention is to steal all of your energy away from you if you give them half a chance These are the Energy Thieves The energy thieves...
  • 97
  • 340
  • 1
Báo cáo y học:

Báo cáo y học: "Comparison of mannitol and methacholine to predict exercise-induced bronchoconstriction and a clinical diagnosis of asthma" pdf

... escalating doses and a hand-held dry powder inhaler device Safety and efficacy of mannitol as a BPT were established in a large Phase III clinical trial in patients with asthma and in healthy ... Relationship between airway responsiveness to mannitol and to methacholine and markers of airway inflammation, peak flow variability and quality of life in asthma patients Clin Exp Allergy 2008, 38(1):43-50 ... with known asthma and healthy subjects without asthma, the specificity and sensitivity of mannitol to identify a clinical diagnosis of asthma was 59.8% and 95.2% and it was 88.7% and 95% when...
  • 13
  • 407
  • 0
Chapter 105. Malignancies of Lymphoid Cells (Part 9) Two other features may be used to assess pptx

Chapter 105. Malignancies of Lymphoid Cells (Part 9) Two other features may be used to assess pptx

... g/dL)] and number of extranodal sites with number of nodal sites (more than four) Low risk (zero or one factor) was assigned to 36% of patients, intermediate risk (two factors) to 37%, and poor ... been proposed that better predicts outcome of rituximab plus chemotherapy-based programs (Table 105 -9) CT scans are routinely used in the evaluation of patients with all subtypes of non-Hodgkin's ... prognosis of patients with non-Hodgkin's lymphoma is best assigned using the International Prognostic Index (IPI) (Table 105 -9) This is a powerful predictor of outcome in all subtypes of non-Hodgkin's...
  • 5
  • 351
  • 0

Xem thêm

Từ khóa: including oestrogen progestogen combination routinely to women with menopausal symptoms and a history of breast cancer hrt12f may in exceptional cases be offered to women with severe menopausal symptoms and with whom the associacan applied voltages be used to produce spinal cord regeneration and recovery in humansexplain how play activities are used to support development of speech and languagecompany s equity and its long term third party financing generally used to fund non current assets and to cover a reasonable margin of current assets this also includes transitory financing situationsa single trait may be influenced by many genesdrugs used to treat affective disorders depression and bipolar syndromeBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ