a single trait may be influenced by many genes
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx
... sequences are listed in Table Available online http://ccforum.com/content/10/5/R139 Table Locus DDAHII-449 Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC ... 0.001; Table 5) Correlation between ADMA levels and inflammatory markers Various inflammatory markers were correlated with ADMA levels on univariate analysis on both day and day (Table 6) Whereas ... patient recruitment, data and sample collection, ELISA and DNA analysis, statistical analysis, and drafting of the manuscript FD and VC participated in the ADMA analysis DK participated in the design...
- 7
- 265
- 0
Báo cáo y học: "The association of meat intake and the risk of type 2 diabetes may be modified by body weight"
... unidentified factors It may be possible that consumption of red meat and processed meat may not increase the risk of type DM, per se, but be part of a dietary pattern that has been associated with a higher ... investigated the association between salted/preserved meat and the risk of type DM stratified by BMI categories (data not shown in Table 3) Salted/preserved meat intake (yes/no) was associated with a ... meat intake and BMI categories was of marginal significance (P=0.08) Processed meats contain preservatives and additives that may put participants at a higher risk of type DM These may include...
- 8
- 701
- 0
Báo cáo khoa học: ADPase activity of recombinantly expressed thermotolerant ATPases may be caused by ppt
... the ‘ADPase-stimulating’ fraction from the above by MonoQ chromatography and analysis by MS (MALDI and, separately, LC ⁄ MS) identified AK as a contaminant that could cause the apparent ADP hydrolysis ... thermophilic archeaons can also use ATP as a phosphoryl transfer donor [9–12] Here we report an apparent ADPase activity in preparations of the recombinant ATPase domain of the AAA+ ATPase NtrC1 ... chromatography, we previously established that a large conformational change in NtrC1C is stabilized upon binding of ADP-BeFx, a Table ATPase and ADPase activities of NtrC1C variants with single amino...
- 9
- 401
- 0
Monkey with a PinWhy you may be missing 6% a year on your investment returns pot
... that the average gap they had calculated between theoretical returns and actual returns was –2.8% over the last 15 years This is not as high as the DALBAR figure, a difference probably explained ... 30 largest shares by market capitalisation in each year; between 1935 and 1962 they are calculated from the FT 30 index, and from 1962 onwards they are derived from the FTSE Actuaries All-Share ... down/up cycle always lasting 30–32 years In 2012, we are 12 years into a secular bear market that started in 2000 There is an old adage, coined by Mark Twain, that “history never repeats itself,...
- 110
- 386
- 0
PERFECT PRESENTATIONS Presenting with impact is a skill that can be learned by anyone
... Public Speaking • Many dread it • Basic skills can be learned to get message across • With application and good training anyone can be a fluent and confident speaker • A great asset you will use ... Introduction Managers • A vast majority not have innate presentation skills • Can learn to present ideas effectively • Being a good public speaker build your selfconfidence Clear Message Public Speaking ... throughout your career Presentation • • • • To get across the message, To inform, To explain, and To train • A powerful way – Presentation: An assumed skill • A skill managers expectd to have acquired...
- 23
- 393
- 0
Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process
... available only for existing plants in Viet Nam due to the availability of the database supplied by the Load Dispatch Centre of Electricity Vietnam National The data made available included many ... concentrated in central and northeast Thailand and along Viet Nam’s coastline; (ii) biomass potential is concentrated in the major rice-growing areas of the Chao Phraya basin, northeast Thailand, and ... assumed to have a payback period years longer The payback periods for Cambodia and the Lao PDR are weighted averages of those for Thailand and Viet Nam The additional renewable energy capacity in...
- 50
- 456
- 0
Tài liệu May váy chữ A đẹp tuyệt cho bé doc
... để may xâu dây thun vào Sau may xâu dây thun bạn chuẩn bị để may túi đính lên Mảnh vải hoa bạn cắt thành hình chữ nhật, may viền đăng ten xung quanh Cắt thêm mảnh chữ nhật màu trắng tương tự may ... viền xung quanh Sau đó, may mảnh màu trắng mảnh hoa lại với Bạn làm bước không, lấy miếng dán lắp vào ph a túi váy Bạn ướm vị trí may Dùng ghim đính túi lên váy, giữ vị trí ổn định Thao tác bạn ... ổn định Thao tác bạn dùng máy may kim để khâu túi lên váy May thêm cúc cỡ to lên túi Giờ váy bé hoàn chỉnh Mặc kèm áo phông, bé th a thích chơi nô đ a Bạn may cho váy tương tự để diện đôi...
- 13
- 1,847
- 9
Báo cáo Y học: Restoring enzyme activity in nonfunctional low erucic acid Brassica napus fatty acid elongase 1 by a single amino acid substitution pdf
... CUT1 (accession number AF129511) and amino acids 264–323 from A thaliana FAE1 (accession number AF053345), HEA B napus cv.s Golden and Ascari (accession numbers AF00953 and AF274750), HEA B napus ... expression in yeast Based on known FAE1 sequences from Arabidopsis and B napus, the forward primer VBE4 (5¢-ACCATG ACGTCCATTAACGTAAAGCTCC-3¢) and the reverse primer VBE3 (5¢-GGACCGACCGTTTTGGGCACG-3¢) ... B oleracea MDE line 103, B rapa MDE line R500 and LEA B napus cv Westar were aligned Amino acid residues at position 282 are shaded in black and indicated by the black arrow The amino acid residues...
- 7
- 381
- 0
Attention Homeowners: You may be eligible for a Montgomery County Property Tax Credit potx
... programs will be reviewed by the State To get an application: • Call the Maryland State Department of Assessments and Taxation (SDAT) at 1-800-944-7403 to order an application form • Download the ... programs You can apply for all three programs with one application The tax credit programs available are: • Maryland Homeowners’ Property Tax Credit Program • Montgomery County Supplemental Property ... Maryland and Montgomery County Property Tax Reduction Programs T he State of Maryland has a program that gives a credit against the homeowner’s property tax bill if the property taxes exceed a...
- 4
- 251
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Báo cáo khoa học: The outer membrane component of the multidrug efflux pump from Pseudomonas aeruginosa may be a gated channel pptx
... that OprM may be a gated channel To date, many gated channels have been reported and the calcium-activated potassium channel from rat adrenal chromaffin cells is one of them Solaro et al [36] have ... heating at 100 °C for Lane 1, molecular mass markers: myoglobin (17 kDa), carbonic anhydrase (30 kDa), aldolase (42 kDa), albumin (66 kDa), a- galactosidase (116 kDa) and myosin (200 kDa); Lane 2, ... liposomes As shown in Fig 3, it was clearly demonstrated that the protease treatment caused a noticeable increase in the diffusion rates of amino acids, peptides and saccharides, and surprisingly allowed...
- 8
- 317
- 0
A survey of technology thinkers and stakeholders shows they believe the internet will continue to spread in a “flattening” and improving world. There are many, though, who think major problems will accompany technology advances by 2020 doc
... permanent surveillance Alaa Seif al-Islam was arrested in May 2005 for protesting the beating of women at a pro-democracy rally in Cairo Seif al-Islam is still in jail, and at least six additional ... English displaces other languages Never has there been a language spoken by so many Linguist David Crystal has estimated in his research that the world has 140 languages in use by at least a million ... cultures A lingua franca is a common language for use by all participants in a discussion At this point, the world's lingua franca is English – for example, it has been accepted as the universal language...
- 115
- 441
- 0
báo cáo hóa học:" Validity of instruments to measure physical activity may be questionable due to a lack of conceptual frameworks: a systematic review" pot
... Functional reserve - Capacity utilization Letrait, 1996 [38] Astma Asthma Impact Record (AIR) index x x Asthma-related health status Definition not reported Gimeno-Santos et al Health and Quality ... fda.gov/downloads/Drugs/GuidanceComplianceRegulatoryInformation/ Guidances/UCM193282.pdf] American Psychological Association, American Educational Research Association, National Council on Measurement ... Franklin BA, Macera CA, Heath GW, Thompson PD, Bauman A: Physical activity and public health: updated recommendation for adults from the American College of Sports Medicine and the American Heart...
- 13
- 357
- 0
Báo cáo hóa học: " Si nanowires by a single-step metal-assisted chemical etching process on lithographically defined areas: formation kinetics" docx
... higher at the beginning of the process and becomes almost parallel to the etch rate of non-patterned areas after an etching time of approximately 60 The etch rate of large non-patterned areas was ... agreement with Cheng et al [30]) compared to 0.38 eV in the case of lithographically patterned areas The two Arrhenius plots are almost parallel to each other, showing that the thermal activation ... Cite this article as: Nassiopoulou et al.: Si nanowires by a single- step metal-assisted chemical etching process on lithographically defined areas: formation kinetics Nanoscale Research Letters...
- 8
- 395
- 0
Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf
... containing solvents are used As it was indicated by Efrima et al [24], Lewis base alkylamine solvents promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates ... approach to band gap calculation is not particularly accurate for polydisperse solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band ... absorption coefficient for SnS nanoparticles a, was calculated from the average absorption index (A) as a ¼ 4pA=k [4] The spectral behavior of the absorption coefficient as a function of energy, hv,...
- 5
- 365
- 0
Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt
... containing solvents are used As it was indicated by Efrima et al [24], Lewis base alkylamine solvents promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates ... approach to band gap calculation is not particularly accurate for polydisperse solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band ... absorption coefficient for SnS nanoparticles a, was calculated from the average absorption index (A) as a ¼ 4pA=k [4] The spectral behavior of the absorption coefficient as a function of energy, hv,...
- 5
- 276
- 0
The Integration of Functions of a Single Variable, by G. H. Hardy pptx
... operations which are always practicable And it has been shown, more generally, that we can always determine by means of such operations whether the integral of any given algebraical function is algebraical ... of an algebraical function and of a finite number of constant multiples of logarithms of algebraical functions All algebraical functions which occur in the integral are rational functions of x and ... x and y can be expressed simultaneously as rational functions of a third variable t, and the integral can be reduced by a substitution to that of a rational function (v.; 2, 7–9) In this case,...
- 86
- 262
- 1
Báo cáo lâm nghiệp: " Predator/prey ratios: a measure of bark-beetle population status influenced by stand composition in different French stands after the 1999 storms" pps
... compare barkbeetle and predator abundances from year to year (GLM analysis in SPSS 11.5) 2.2 Data analysis In each site, maps of the stands where the traps were set-up and of the neighbouring stands ... 302 N Warzộe et al Table I Location and characteristics of the study sites Site Location (department) Elevation (m) Area (ha) Age (year) HA Hanau (Moselle) 260 25 110130 ST Steinbach (Bas-Rhin) ... between sites and years was carried out using a two-way analysis of variance of the angular transform of the predator/prey ratio, with the site, year, and their interaction entered as fixed factors...
- 8
- 363
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25