0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Exploring the role of good leadership and corporate governance practices in improving institutional investment to listed companies in vietnam stock market

báo cáo khoa học:

báo cáo khoa học: " Exploring the role of organizational policies and procedures in promoting research utilization in registered nurses" potx

... factors influencing the use of RBPs among staff nurses in the Canadian province of Newfoundland and Labrador with the specific aim of understanding the role of P&Ps in promoting research utilization ... understanding of the factors that influence nurses' use of RBPs, and the role that P&Ps may play in promoting research utilization in nurses Our findings suggest nurses use P&Ps to guide their ... Use of nursing practice research findings Nursing Research 1987, 36:344-349 Michel Y, Sneed NV: Dissemination and use of research h findings in nursing practice Journal of Professional Nursing...
  • 11
  • 417
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The role of Bcl-xL and nuclear factor-kB in the effect of taxol on the viability of dendritic cells" ppsx

... cytokines than the ContDCs, at 24, 48 h of incubation time (Fig 2) However, the taxol concentration used was critical for the level of cytokine production; μg/ml of taxol induced only marginal ... by that of the β-actin band, and the ratio at h was set at 100% (B) Fig NF-κB involvement in the taxol- induced effects on dendritic cells (DCs) The mobilization of NF-κB p65 molecules in DCs was ... may further confirm their role of taxol- treated DCs Although the expression of Bax was increased in TaxolDCs, the expression of Bax occurred later than that of Bcl-xL, which implies that the pro-apoptotic...
  • 5
  • 335
  • 0
The role of CDC42, 1RSP53 and its binding partners in filopodia formation

The role of CDC42, 1RSP53 and its binding partners in filopodia formation

... actin binding proteins (ABPs) which includes the sequestering proteins and the capping proteins Sequestering proteins inhibit polymerization by binding to monomeric G-actin, sequestering them ... modification of the actin network The ABPs have the following activities; Profilin and ADF cofilin bind G- and F-actin and they are mostly concentrated at the leading edge of the cell They promote the ... responsible for the crosslinking, severing, sequestering of monomeric actin subunits and capping of existing actin filaments This group of proteins is collectively known as actin binding proteins (see...
  • 341
  • 411
  • 0
The role of nitric oxide and other gaseous mediators in cardiovascular disease models; emphasis on septic shock

The role of nitric oxide and other gaseous mediators in cardiovascular disease models; emphasis on septic shock

... THE ROLE OF NITRIC OXIDE AND OTHER GASEOUS MEDIATORS IN CARDIOVASCULAR DISEASE MODELS: EMPHASIS ON SEPTIC SHOCK FARHANA ANUAR B.Sc.(Hons.), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... pathogenesis of tissue damage incurred by the host in the course of severe sepsis and septic shock 2.3 Evidence for the involvement of NO in sepsis and septic shock 2.3.1 In vivo overproduction of NO in ... types of DNA damage namely (i) the modification of DNA bases via both oxidation and nitration reactions and, (ii) the induction of nicks and breaks in the DNA strand (Szabo & Ohshima, 1997) DNA single-strand...
  • 222
  • 297
  • 0
THE ROLE OF TRANSFORMATIONAL LEADERSHIP BEHAVIORS IN AFFECTIVE EMPLOYEE ENGAGEMENT AN EMPIRICAL STUDY IN THE TWO INDUSTRIES OF RETAIL AND FINANCIAL SERVICES IN HO CHI MINH CITY

THE ROLE OF TRANSFORMATIONAL LEADERSHIP BEHAVIORS IN AFFECTIVE EMPLOYEE ENGAGEMENT AN EMPIRICAL STUDY IN THE TWO INDUSTRIES OF RETAIL AND FINANCIAL SERVICES IN HO CHI MINH CITY

... important to test the link between transformational leadership behaviors and affective employee engagement in the industry of retail and financial services in Ho Chi Minh City and also to explore employees’ ... and affective employee engagement by surveying the employees The target population of the study included the employees in Ho Chi Minh City currently working in the industry of retailing and financial ... leadership behaviors and affective employee engagement in the industry of retail and financial services in Ho Chi Minh City, Vietnam Of course, the data for the study is delimited to the surveyed employees...
  • 84
  • 510
  • 1
Political connections, finance and growth the role of party leadership positions

Political connections, finance and growth the role of party leadership positions

... of managerial experience of the CEO and the education level of the CEO Column (2) regresses Party leader on log of firm assets, years of managerial experience of CEO and the education level of ... see the evolution of the nexus between power and money Also, most studies focus on the benefits of political connections; we could expand the understanding of political economy by documenting the ... as if the manager is a member of the party and if he is not a member Party Leader is a subset of Party Member as all party leaders are by definition party members For the private sector, the General...
  • 61
  • 279
  • 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... W, Thanki N, Jaenicke R & Wierenga RK (1997) A double mutation at the tip of the dimer interface loop of triosephosphate isomerase generates active Effect of mutation on the dimer interface of...
  • 15
  • 635
  • 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... both the wild-type protein and mutants E142O and K13 3A Thermal analysis of protein unfolding The DSC curves of the wild-type protein and the mutants K13 3A, E142O, W14 0A and W140O are shown in Fig ... Our CD and DSC data show that the W140 in SNase is the amino acid responsible for the stability of the whole protein However, in comparison with the wild-type protein, the mutant W14 0A retains significant...
  • 7
  • 551
  • 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation ... dimensional model of the wild type (A) and mutant alkaline phosphatases G26 1A (B) and G26 1A /Y2 6 9A (C); only residues that where studied are shown respectively By introducing an Ala residue in the place...
  • 6
  • 488
  • 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786 2957 84 6 3.91 ± 1.06 3.76 ± 1.61 2 .82 ± 0.92 ... Faussner et al Role of helix and C-termini in bradykinin receptors Fig Schematic representation of the C-terminal B1wt and B2wt sequences and chimera thereof The C-terminal sequences beginning at transmembrane...
  • 12
  • 595
  • 0
Báo cáo

Báo cáo "The role of color luminescence centers Mn, Cu, Co in the semicondutors with wide band gap ZnS, ZnO and their applications " pptx

... by Cu2+, Mn2+, Co2 + ions [7-11] In this paper, we study the role of color luminescence centers Cu, Mn, Co in the semiconductors with wide band gap of ZnS, ZnO and test application of ZnS:Cu material ... band is greater than that of the blue band As increasing the concentration of Cu, the intensity of the blue band decreases while the intensity of the green band increases and reaches to maximum ... shows the PL spectra of bulk sample ZnO :Co with variation of Co concentration When Co (xCo = 2.10-2 mol%) was doped in ZnO, the presence of Co2 + ions resulted in change in the PL spectrum of ZnO...
  • 7
  • 466
  • 0
Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf

Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf

... determined and quantied To ll these gaps, residues Y3 31, R97 and E187 of Sfbgly50 were replaced through site-directed mutagenesis by phenylalanine (Y331F), methionine (R97M), lysine (R97K) and ... stability of the recombinant Sfbgly50 (n) was checked by incubating the enzyme in the same buers for an equal length of time and determining the remaining activity in the pH optimum Fig Inactivation of ... 97 and 3 31 side chains are conserved in the mutants R97M and Y331F, but the hydrogen bond-forming atoms have been removed In mutant E187D, the distance between the catalytic nucleophile and the...
  • 10
  • 522
  • 0
Báo cáo khoa học: Dissecting the role of protein–protein and protein–nucleic acid interactions in MS2 bacteriophage stability potx

Báo cáo khoa học: Dissecting the role of protein–protein and protein–nucleic acid interactions in MS2 bacteriophage stability potx

... protein–RNA and protein–protein interactions in virus stability, measuring the effects of urea, GdnHCl and high pressure on the structure and stability of whole particles (bacteriophage MS2 and ... the role of protein–protein and protein–RNA interactions in virus stability is not completely understood, and we have investigated these questions in this work We sought to determine the role of ... [5,14] To understand the importance of capsid protein–protein contacts for the stability of coat protein, we determined the stability of dlFG and compared it with the stability of the genetically...
  • 13
  • 448
  • 0

Xem thêm

Từ khóa: enos uncoupling in cardiovascular diseases the role of oxidative stress and inflammationthe role of teachers schools and communities in quality educationexplain the role of art music and dance in african societythe role of students attitudes and motivation in second language learning in online language coursesthe role of sound music and sound effect in the film industrythe role of oxidative stress and inflammation in dry eye diseasethe role of effective communication and interpersonal interaction in health and social careanalyze the role of critical thinking and education for lifewhat is the role of effective communication and interpersonal interaction in health and social carethe role of oxidative stress and antioxidant treatment in experimental diabetic neuropathythe role of oxidative stress and endothelial injury in diabetic neuropathy and neuropathic painthe role of effective communication and interpersonal interaction in health and social care contextthe role of critical thinking and communication in the construction industrythe role of oxidative stress and antioxidants in male infertilitythe role of teachers schools and communities in quality education a review of the literatureNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ