Yarn breakage practically found in warping and its remedy
Yarn breakage practically found in warping and its remedy
... EFFECT More breaks in winding and warping Formation of holes and stains in cloth CAUSES Use of cottons differing widely in the properties in the same mixing Improper mixing Maintaining low relative ... different types of yarn faults in warping for 16/1 count carded yarn OVER LAPPING; 5% KEY FINDINGS Found different types of yarn and package faults from warping the main cases of warp yarn breakage is ... double yarn which one yarn is straight and other is coiled over it EFFECT Breaks during winding and warping Causes streaks in the fabric CAUSES Bad piecing by robot Improper mixing Improper feeding...
- 38
- 380
- 0
CANON LTD IN VIETNAM AND ITS MARKETING
... 0918.775.368 CANON VIETNAM CO LTD AND ITS MARKETING harmoniously living and working together into the future” (Canon Vietnam, n.d) Hence, its purpose is to bring goods thing to all people in the world ... 0918.775.368 CANON VIETNAM CO LTD AND ITS MARKETING In order to societal marketing, Canon must pay many kinds of cost for marketing activities, such as researching market, advertising, and social ... CO LTD AND ITS MARKETING Canon marketing activities because marketing focus on customers while their behavior is different This report finds out useful information about marketing activities and...
- 29
- 513
- 0
The verb to have in english and its equivalents in vietnamese
... can find the equivalents in using the verb "to have" both in English and in Vietnamese because the basic meaning of the verb to have in the two languages are quite the same However , the meaning ... ordinary verb and its equivalents in Vietnamese - Helping them know and apply the verb to have in some constructions and its equivalents in Vietnamese - By means of teaching suggestions of the verb ... encourages us to choose the topic: The verb "to have" in English and its equivalents in Vietnamese - Aims of the study - Helping Vietnamese learners understand the usages of the verb to have when...
- 49
- 752
- 4
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT...
- 12
- 772
- 0
Báo cáo khoa học: "Categorial Fluidity in Chinese and its Implications for Part-of-speech Tagging" pptx
... verbalisation in Chinese was observed in Tai (1997) In other words, verbs are more freely deverbalised than nouns denominalised This fluidity between verbal and nominal status of verbs can in theory ... nouns, and the implications this phenomenon might have for POS tagging References Chinese Knowledge Information Processing Group (CKIP) 1993 iirt,=,m,3 }K (EN) Technical Report no.9305, Academia Sinica, ... LIVAC, A Chinese Synchronous Corpus, and Some Applications In Proceedings of the ICCLC International Conference on Chinese Language Computing, Chicago, pages 233-238 Xia, F 2000 The Part-Of-Speech...
- 4
- 397
- 0
A study on rhyming slang in English and its equivalents in Vietnamese.
... Some slang words and expressions can spread outside their original arena, and some may even lose their slang status and become accepted as a standard language; for example, in English : Adam and ... dialect and common in London at the time, containing aspects of Cockney rhyming slang, Romany,Back slang, Italian,theatre language ,criminal language….etc But today, it seems to be died out Example: ... words and expressions can spread outside their original arena, and some may even lose their slang status and become accepted as a standard language Often, the widespread adoption of a slang term...
- 51
- 906
- 5
New Concepts in Diabetes and Its Treatment - part 1 ppt
... 19 99 Belfiore F (ed): Frontiers in Diabetes Basel, Karger, vol 8 /19 87, vol 9 /19 90, vol 10 /19 90, vol 11 /19 92, vol 12 /19 93, vol 14 /19 98 Bray G, Bouchard C, James WPT (eds): Handbook of Obesity New ... New Concepts in Diabetes and Its Treatment Basel, Karger, 2000, pp 1 2 Introduction Diabetes mellitus and its complications are clinical conditions of growing importance both from the clinical ... in subjects with high insulin sensitivity (lean and/ or trained subjects) and elevated ( ?15 U/ml) in insulin-resistant subjects It should be pointed out that an apparent normal insulin level in...
- 27
- 323
- 0
New Concepts in Diabetes and Its Treatment - part 2 docx
... MAP-K>mitogen-activated protein kinase; PC-1>an ecto-protein kinase probably interfering with insulin receptor tyrosine kinase; PI3-K>phosphatidylinositol-3 kinase; PIP2>phosphatidylinositol-4,5-P; ... protein; Gs and Gi> stimulatory and inhibitory G proteins; Ins>insulin receptor; IP3>inositol-1,4,5trisphosphate; IRS1>insulin receptor substrate-1; IRS2>insulin receptor substrate -2 ; M>muscarinic ... Glipizide Gliclazide Gliquidone Glimepiride Repaglinide1 1 .25 20 0.75– 12 2.5–40 80– 320 30– 120 1–8 0.5–16 1 2 1 2 1 2 1–3 1–3 1–4 16 24 12 24 12 24 10 20 6– 12 #24 4–6 Liver/kidney Liver/kidney Liver/kidney...
- 27
- 365
- 0
New Concepts in Diabetes and Its Treatment - part 3 docx
... 1,7 23 1,784 1,844 1,905 1,814 33 32 32 31 31 .9 2,240 2 ,31 9 2 ,39 7 2,476 2 ,35 8 38 37 36 36 36 .8 2,585 2,675 2,766 2,857 2,721 43 42 41 40 41.7 2,929 3, 032 3, 135 3, 238 3, 084 68 72 76 80 74 25 24 23 ... 62 24 23 23 22 22.8 1 ,32 3 1 ,38 3 1,442 1,502 1,4 13 31 30 29 29 29.7 1,720 1,798 1,875 1,9 53 1, 836 35 35 34 33 34 .2 1,985 2,074 2,164 2,2 53 2,119 40 39 38 38 38 .8 2,249 2 ,35 1 2,452 2,5 53 2,401 ... 62 23 22 21 21 22.0 1 ,30 9 1 ,34 2 1 ,37 4 1,407 1 ,35 8 30 29 28 27 28.6 1,701 1,744 1,787 1,829 1,765 35 34 32 31 33 .0 1,9 63 2,012 2,062 2,111 2, 037 40 38 37 35 37 .4 2,225 2,281 2 ,33 6 2 ,39 2 2 ,30 9...
- 27
- 300
- 0
New Concepts in Diabetes and Its Treatment - part 4 ppsx
... (episodic therapy and CSII may increase insulin immunogenicity) Genetic factors (HLA-A2-B 44 and HLA-B 4 4- DR7 predispose to immune complications of insulin therapy) Residual insulin secretion (when ... Absorption and chapter Belfiore/Iannello 96 Table Immunoregulation therapies in animal models IL-2, IL -4 , IL-10 and TNFAnticytokine and anti-IFN- antibodies Anti T-cell antibodies, anti-CD3, -CD4, -CD8 ... Altered Insulin Responses Conditions of altered insulin responses include: (a) insulin resistance linked to occult infections; (b) iatrogenic hypoglycemia or factitious inten- Insulin Treatment in...
- 27
- 387
- 0
New Concepts in Diabetes and Its Treatment - part 5 pdf
... simultaneous determinations every 4–6 h of glycemia, insulinemia and C-peptide during fasting periods of 24, 48 and 72 h In insulinoma, glycemia falls while C-peptide and insulinemia remain near-unmodified ... -blockers) Increased glucose utilization -Cell tumor or insulinoma Functional hypersecretion of -cells Autoantibodies to insulin Autoantibodies to insulin receptors Sepsis Insulin or insulin-releasing ... test) (10) Proinsulin determination (? 25% of total insulinemia in about 85% of patients with insulinoma, compared to 10– 15% of the normal subjects; this proinsulin excess is lacking in factitious...
- 27
- 358
- 0
New Concepts in Diabetes and Its Treatment - part 6 pot
... retinopathy Retinopathy Inside the retina (background retinopathy) Not vision-threatening In front of the retina (neovascularizations) Simple Vision-threatening Maculopathy Proliferative retinopathy ... clinically Bek 1 46 Table Characteristics of new vessels in proliferative diabetic retinopathy requiring photocoagulation treatment and intraretinal microvascular abnormalities not requiring treatment ... The effect of intensive diabetes treatment on the progression of diabetic retinopathy in insulin-dependent diabetes mellitus Arch Ophthalmol 1995;113: 36 51 Early Treatment Diabetic Retinopathy Study...
- 27
- 323
- 0
New Concepts in Diabetes and Its Treatment - part 7 pdf
... density lipoproteins, the insulin resistance syndrome and noninsulin-dependent diabetes Curr Opin Lipidol 1996 ;7: 1 67 171 Coppack SW: Postprandial lipoproteins in non-insulin-dependent diabetes mellitus ... therapy and progression to clinical albuminuria in patients with insulin-dependent diabetes mellitus and microalbuminuria BMJ 1995;311: 973 – 977 Mogensen CE: Combined high BP and glucose in type diabetes: ... renal disease Diabetes 1996;45: 974 – 979 Gylling H, Miettinen TA: Treatment of lipid disorders in non-insulin-dependent diabetes mellitus Curr Opin Lipidol 19 97; 8:342–3 47 International Diabetes Federation...
- 27
- 208
- 0
New Concepts in Diabetes and Its Treatment - part 9 pdf
... Problems in Diabetes 217 Belfiore F, Mogensen CE (eds): New Concepts in Diabetes and Its Treatment Basel, Karger, 2000, pp 218–228 Chapter XVI Erectile Dysfunction in Diabetes and Its Treatment ... Multifactorial Intervention in Type Diabetes mellitus 231 Insulin Insulin treatment can be given as monotherapy or as combination therapy with insulin and oral hypoglycaemic agents From studies comparing ... found in both the penile smooth muscle tissue and the eyes Moxisylyte is a selective drug used in 1 0- to 2 0- g doses Its minimal side effects include penile pain and prolonged erections Vasointestinal...
- 27
- 405
- 0
Từ khóa: salt tolerance in plants and its effectsforeign direct investment in vietnam and its impact on economic growthfrom eye world to brain eye self reflexivity in art and its education4 feto maternal cell traffic in pregnancy and its long term consequencesheart in english and its synonyms in vietnameseibuprofen loading and release in fa32 and its derivativesa structure found in numerous proteases and implicated in protein bindingand its treatment in a machine translation system sevents in a document and its applicationcharacteristics of obesity and its related disorders in chinamodeling obesity and its associated disorders in drosophilaexcretion of cocaine and its metabolites in mandetection of cocaine and its metabolites in breast milkcocaine and its metabolites in urinedenial of service dos attack and its possible solutions in vanetNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ