development of a mid-infrared technique for determination of soil nitrate content
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... using the following primers: LTA-1F, 5Â-CTCGAGATGGATAAAGTTTTAAACAGAG-3Â and LTA-1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former, and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCAGGGG-3Â ... long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki Yoshida and ... accessible method toexamine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis of ECs and their heterogeneity in various vascular beds. The early mortality...
- 11
- 873
- 0
Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf
... AccessMethodology Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes virusesSarah Watson1, ... Ref-erence gene selection for quantitative real- time PCR analy-sis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomeg-alovirus infections. ... researchers of these viruses with a shortlist of potential housekeeping genes to use as normalisers for QPCR experiments.Background Quantitative real- time PCR (QPCR) is an invaluable tool for the...
- 5
- 481
- 0
Báo cáo hóa học: " Feasibility of the adaptive and automatic presentation of tasks (ADAPT) system for rehabilitation of upper extremity function poststroke" pptx
... RESEARCH Open Access Feasibility of the adaptive and automatic presentation of tasks (ADAPT) system for rehabilitation of upper extremity function post-strokeYounggeun Choi1,2, ... needed for effective reha-bilitation of upper extremity functions [3-6]. In view of this shortcoming of the conventional medical practicemodel, a growing number of robotic systems for the rehabilitation ... therapists to increase the duration and intensity of therapy in rehabilitation settings.Here, we argue that to further enhance the efficacy of therapy targeting the recovery of upper extremity * Correspondence:...
- 12
- 612
- 0
Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot
... AccessMethodology Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes virusesSarah Watson1, ... researchers of these viruses with a shortlist of potential housekeeping genes to use as normalisers for QPCR experiments.Background Quantitative real- time PCR (QPCR) is an invaluable tool for the ... such study has been carried out in cells infected with human immunodeficiency virus (HIV) or the herpes viruses, herpes simplex virus (HSV) and varicella zoster virus (VZV). Thus, in this study...
- 5
- 574
- 0
báo cáo hóa học:" Improving accuracy of total knee component cementation: description of a simple technique" ppt
... Note Improving accuracy of total knee component cementation: description of a simple techniqueWilliam B Lutes, Michael A Flierl, Michael R Dayton and Steven J Morgan*Address: Department of Orthopaedic ... and anterior knee pain after total knee arthro-plasty. Clin Orthop Relat Res 2001, 392:46-55.11. Matsuda S, Miura H, Nagamine R, Urabe K, Hirata G, Iwamoto Y:Effect of femoral and tibial component ... choice of implant [8,9]. Mala-lignment of TKA components has been associated with knee pain [10], poor patellar tracking [11], flexion gapinstability [12], loss of motion, and early implant failure[13-15]....
- 4
- 247
- 0
Báo cáo hóa học: " A Nanopatterning Technique: DUV Interferometry of a Reactive Plasma Polymer" ppt
... multiple irradiations.’’ Soppera toldNano Spotlight (Fig. 3).This approach developed by Soppera and his colleaguesallows the generation of multi scale topographical orchemical images and creates ... field of biology are expected from this work: we havealready validated that such surface was compatible withcell or bacteria development. Such patterned polymer filmsappear as excellent candidate ... spacing and the depth of the surface corrugation can beeasily addressed by tuning the photonic parameters. Wealso demonstrate here that various geometries of patternscan be obtained by...
- 2
- 210
- 0
Báo cáo hóa học: " TWO TOPOLOGICAL DEFINITIONS OF A NIELSEN NUMBER FOR COINCIDENCES OF NONCOMPACT MAPS" pptx
... N∼Hp0,q0.(4.17) TWO TOPOLOGICAL DEFINITIONS OF A NIELSEN NUMBER FOR COINCIDENCES OF NONCOMPACT MAPSJAN ANDRES AND MARTIN VăATHReceived 25 August 2003The Nielsen number is a homotopic invariant and a lower ... havesuch a form. 66 Topological definition of a Nielsen number of (p1,q1). Note that this association is actually independent of n, that is, the mappingC → D defined in this way is actually a restrict ... M. I. Kamenski˘ı, A. S. Potapov, A. E. Rodkina, and B. N. Sadovski˘ı, Measures of Noncompactness and Condensing Operators, Operator Theory: Advances and Applications,vol. 55, Birkhăauser...
- 21
- 262
- 0
Báo cáo khoa học: "The efficacy of preoperative PET/CT for prediction of curability in surgery for locally advanced gastric carcinoma" ppsx
... of Surgical Oncology 2010, 8:86http://www.wjso.com/content/8/1/86Page 5 of 7 RESEARC H Open AccessThe efficacy of preoperative PET/CT for prediction of curability in surgery for locally advanced gastric ... approximately45 minute s before receiving an intravenous injection of 440 MBq of 18F-FDG. Scanning began 60 minutes later.A combined PET/CT in- line system (Biograph LSD,Siemens, Knoxville, TN) was used for ... recentlyannounced that preoperative PET/CT for gastric cancerpatients can be recommended as an option of preopera-tive staging [5], the benefits of PET/CT remain uncertain.Therefore, we analyzed informat...
- 7
- 470
- 0
Báo cáo y học: "Ultrasound guided injection of dexamethasone versus placebo for treatment of plantar fasciitis: protocol for a randomised controlled trial" potx
... outcomes and analysing data. Primary outcomes will be pain measured by the Foot Health Status Questionnaire and plantar fascia thickness measured by ultrasound at 4, 8 and 12 weeks. All data analyses ... Ultrasound guided injection of dexame-thasone versus placebo for treatment of plantar fasciitis: protocol for a ran-domised controlled trial Journal of Foot and Ankle Research 2010, 3:15 JOURNAL OF ... proximal plantar fascia. Toconfirm the diagnosis of plantar fasciitis, the dorso-plan-tar thickness of the plantar fascia will be measured byultrasound at a standard location where the fascia...
- 8
- 352
- 0
Báo cáo y học: " Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments" pps
... implementation in healthcare organizations, informed by the implementa-tion of a major patient safety initiative at a large, multi-site, academic hospital in Toronto, Canada. Candidatefactors were retained ... Canada, 2Department of Paediatrics, University of Toronto, Toronto, Canada, 3Department of Health Policy, Management and Evaluation, University of Toronto, Toronto, Canada, 4Centre for Health ... randomization and stratification of patients to clinical trials. J Chronic Dis 1974, 27:365-375.8. Kenjo Y, Antoku Y, Akazawa K, Hanada E, Kinukawa N, Nose Y: Aneasily customized, random allocation...
- 8
- 347
- 0
báo cáo khoa học: " Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments" doc
... AccessResearch article Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departmentsChad Andrew ... implementation in healthcare organizations, informed by the implementa-tion of a major patient safety initiative at a large, multi-site, academic hospital in Toronto, Canada. Candidatefactors were retained ... suggesting that our minimization factors dodiscriminate and are suitable for use in the minimization algorithm to guide the allocation of the intervention to hospitals. All respondents rated factor...
- 8
- 236
- 0
Báo cáo y học: " Randomised controlled trial of the clinical and cost effectiveness of a specialist team for managing refractory unipolar depressive disorder" ppt
... 10:100http://www.biomedcentral.com/1471-244X/10/100Page 5 of 11 STUD Y PROT O C O L Open Access Randomised controlled trial of the clinical and cost effectiveness of a specialist team for managing refractory unipolar depressive disorderRichard ... general practitioners and p sychother-apy services in England and Wales.2. Euroqol 5 D [32] as a measure of quality of li fe and costs from health and social care and societyperspectives measured ... group the participant has been randomised to at the end of 12months treatment. At the end of the study, theseguesses will be compared against chance.Statistical analysisStatistical analysis for...
- 11
- 302
- 0
Báo cáo sinh học: "Evaluation of the VP22 protein for enhancement of a DNA vaccine against anthrax" pptx
... usingprimers VP22 F9 (5' ACTCTAGCTAGCACGGCGCCAAC-CCGATCCAAGACA 3') and VP22 R8 (5'ATTGTCACGGTCTGGAACCGTAGGAGCAGCTGGACCT-GGACCCTCGACGGGCCGTCTGGGGCGAGA 3'). Addi-tionally, the gene ... kinase [3] or the BioMed CentralPage 1 of 9(page number not for citation purposes)Genetic Vaccines and TherapyOpen AccessResearchEvaluation of the VP22 protein for enhancement of a DNA vaccine ... small animal models, their efficacy inlarger animal models and primates is insufficient. In thisstudy, we evaluate the potential of VP22 to enhance DNA vaccines against anthrax. The spore-forming...
- 9
- 331
- 0
Báo cáo sinh học: "Comparison of four statistical methods for detection of a major gene in a progeny test design" pptx
... Finally, the jackknife standard deviation of the estimated quantile varies, for the5% case, between 0.23 and 0.89, with a mean value of 0.52 and, for the 1% case,between ... and validity. Four methods are compared on simulated data. METHODS The four methods considered rely upon the same information structure and thesame type of test statistics.Experimental ... of thelikelihood ratio for mixture of multinormal distributions. Tech. Bull., STB 72-2,Naval Personnel and Training Research Laboratory, San DiegoAPPENDIXApplication of...
- 17
- 352
- 0
Từ khóa: dissection a new technique for en bloc resection of large superficial tumor in the esophagusa new technique for recording joint soundsa new technique for calibrating asset pricing modelssmb as a promising technique for industrial separations using imackirtan kriya meditation a promising technique for enhancing cognition in memory impaired older adultsdevelopment of a regional risk management framework for apec economies for use in the control and prevention of introduced marine pestsa simplified method for the determination of bulldozing resistancedevelopment of a digital imaging system for objective measurement of hyperpigmented spots on the facedevelopment of a terrestrial index of ecological integrity tiei a new tool for ecosystem managementcommercializing cultural heritage criteria for a balanced instrumentalization of traditional cultural expressions for development in a globalized digital environmentethics in engineering as a prerequisite for technological development of societies mehdi bahadori and mahmood yaghoubistudy which is shown in appendix a readability and understandability were important for thorough collection of data factors that were considered in the development of the survey included font and paper siiso iec 9126 1 as a supporting means for the system development process of a patient information web servicedevelopment of a simple model for vaccination against haemonchusdevelopment of a stress insensitive mgcuzn nicuzn composite ferrite useful for microinductors apBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ