Báo cáo y học: " Kinetics of hepatitis C virus RNA load during pegylated interferon alpha-2a and ribavirin treatment in naïve genotype 1 patients" potx
Báo cáo y học: " Kinetics of hepatitis C virus RNA load during pegylated interferon alpha-2a and ribavirin treatment in naïve genotype 1 patients" potx
... Tanabe Y, Nawata H: Decline of hepatitis C virus load in serum during the first 24 h after administration of inter-feron-beta as a predictor of the efficacy of therapy. J Hepatol20 01, 34 (1) :10 0 -10 7. 13 . ... treatment outcome in combination of high-dose inter-feron induction vs. pegylated interferon plus ribavirin fornaive patients infected with hepatitis C virus of genotype 1b and high viral load. J ... 2005, 75 (1) :27-34. 15 . Bruno R, Sacchi P, Ciappina V, Zochetti C, Patruno S, Maiocchi L,Filice G: Viral dynamics and pharmacokinetics of peginter-feron alpha-2a and peginterferon alpha-2b in naive...
- 5
- 322
- 0
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"
... Brechot C, Lamas E. Prevalence and genotypes of hepatitis C virus in blood donors and in patients with Int. J. Med. Sci. 2006, 3 41 International Journal of Medical Sciences ISSN 14 49 -19 07 ... hepatocarcinoma in one study. [5] This same genotype was also found in 82% of 14 7 chronic hepatitis C patients in Chile as well. [48] Genotype 1b is also dominant in Japan. [72-74] In Beijing, China, ... Fairclough D, Bacchus R, Ring C, Garson J. Hepatitis C virus in Egyptian blood donors in Riyadh. Lancet 19 91; 33: 359-60. 18 . Darwish NM, et al. Hepatitis C virus infection in blood donors in...
- 6
- 486
- 0
Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx
... associationbetween the places of infection of the patients and geno-type. However, genotype 4 was found only in north and west of country and mixed infection with genotype 1a and 1b only in center. ... splenomegaly, ascitis, edema, cirrhosis, grade and stage of liver biopsy, and child score and status (inactive,chronic, cirrhotic and active) of the disease; revealinginexistence of any association ... cases with mixed infection with genotype 1a and 1b (2, 10 0%), 1a (12 , 20.3%), 3a (6, 13 %), and 1b (3, 11 .5%). Any cases with genotype 4 hadno history of jaundice.From the 15 6 patients, only...
- 6
- 337
- 0
Báo cáo y học: " Seropositivity of Hepatitis B virus and Hepatitis C virus dual Infection among blood donors in Nyala Teaching Hospital" pot
... hepatitis C virus (HCV) and occult HBV and HCV dual infection. Journal of Medical Virology2007, 79:236-2 41. 10 . Liu Z, Hou J: Hepatitis B virus (HBV) and hepatitis C virus (HCV) dual infection. International ... Journal of Medical Science 2006,3:57-62. 11 . Shi J, Zhu L, Liu S, Xie WF: A meta-analysis of case control stud-ies on the combined effect of hepatitis B and C virus infec-tions in causing ... A: Hepatitis C virus infection in chronic hepati-tis B virus carriers. Journal of Infectious Diseases 19 91, 16 3:400-402. 14 . Abou MA, Eltahir YM, Ali AS: Seroprevalence of Hepatitis B virus and...
- 2
- 348
- 0
Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt
... TheIRES 1- 515 /Fluc unit was then reamplified by PCR usingforward (5'-gcgcgcactagtgccagccccctgatgggggcgacac-3') and reverse (5'-gcgcgcactagtttacaatttggactttccgcccttc-3')oligonucleotides, ... expression vector was conceived bycloning in psiSTRIKE the pre-mmu-miR-328 sequence(5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagcccctggccctctctgcccttccgtcccctgt ttttc-3') (Promega). ... obtained by cloning 1 or 3 copies of the PC (5'-atctcaacggaagggcagagagggccagatctc-3') or WT(5'-atctcgtccctgtggtaccctggcagagaaagggccaatctcaatctc-3')binding sites into the...
- 13
- 362
- 0
Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot
... recovery of leucocytes the virus wasagain cleared spontaneously. These findings suggest thatagranulocytosis can lead to reactivation of hepatitis C virus and that recovery from hepatitis C ... by liver function deterioration and reappearance of HCV -RNA. Propylthiouracil was discontinued and his leukocyte counts increased.Twenty-eight weeks after onset of acute hepatitis C, no HCV -RNA ... Wedescribe here the case of a 69 year old man with acute hep-atitis C virus infection who developed propylthiouracil-induced leucocytopenia, followed by cytopenia-inducedHCV recurrence. With...
- 3
- 232
- 0
Báo cáo y học: " Prevalence of hepatitis delta virus infection among hepatitis b virus surface antigen positive patients circulating in the largest province of pakistan" pptx
... PCR reaction mixture (2.5 mM MgCl2, a 10 0 μMconcentration of each of the four deoxynucleotides(dNTPs), 10 pM of each outer sense nucleotides 695- 718 {5’-CATGGTCCCAGCCTCCT CGCTGGC-3’ }and outer ... livercells are previously been infected by hepatitis B virus. HDV co-infection or super infection leads to the cirrho-sis of the liver and finally hepatocellular carcinoma(HCC) or liver canc er ... initial ly incubate the samplesfor 2 min at 95 C, followed by 35 cycles consisting of 95 C for 1 min, 64 C for 1 min, an d 72 C for 1 min.Second round PCR was performe d with the same reac-tion...
- 5
- 315
- 1
Báo cáo y học: " Characterization of Hepatitis B virus (HBV) genotypes in patients from Rondônia, Brazil" doc
... recently reported the pre-sence of this genotype in a specific community in Colombia [11 ] and in the north of India [12 ]. Genotype * Correspondence: monica.viviana@usp.br2Laboratory of Gastroenterology ... and asialoglycoprotein receptor on hepatocytes may be indispensable forviral binding and entry. J Viral Hepat 2006, 13 :11 -18 .5. McMahon BJ: The natural history of chronic hepatitis B virus infection.Hepatology ... JA, Olinger CM, Charpentier E,Muller CP: Detection of a new subgenotype of hepatitis B virus genotype A in Cameroon but not in neighbouring Nigeria. Clin MicrobiolInfect 2 010 .20. Bowyer SM,...
- 7
- 533
- 0
Báo cáo khoa học: "Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc
... 5).Considering the duration of diabetes condition amongsubjects recruited, in this study, participants were groupedinto: 1 10 years, 11 15 years, and 16 years above. Thosewith 1 10 years of ... sub-jects, which covers clinical characteristics, demographiccharacteristics and social behaviors, which could be possi-ble risk factors to acquiring HCV.Statistical AnalysisGeneral descriptive ... transfusion of infected blood,transplantation of infected organs, and sharing injectiondrug equipment [3].DiagnosisThe diagnosis of HCV infection can be made by detectingeither anti-HCV or HCV RNAof...
- 5
- 463
- 0
Báo cáo khoa học: " Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc
... Pirlich M, Balks HJ, Selberg O: Glucose intolerance in liver cirrhosis: role of hepatic and non-hepatic influences. EurJ Clin Chem Clin Biochem 19 94, 32 (10 ):749-58.9. Del Vecchio Blanco C, Gentile ... sub-jects, which covers clinical characteristics, demographiccharacteristics and social behaviors, which could be possi-ble risk factors to acquiring HCV.Statistical AnalysisGeneral descriptive ... Disease Control and Prevention: Recommendationsfor prevention and control of hepatitis C virus (HVC) infec-tion and HVC-related chronic disease. Morbidity and MortalityWeekly Report 19 98, 47 :1- 39.5....
- 5
- 209
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenprevention of hepatitis c virusrecommendations for prevention and control of hepatitis c virus hcv infection andrecommendations for prevention and control of hepatitis c virus infectionprogress toward prevention and control of hepatitis c virus infectionrecommendations for prevention and control of hepatitis c virusprevention and control of hepatitis c virusprevention of hepatitis c virus infectionbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ