Báo cáo y học: " Reservoir cells no longer detectable after a heterologous SHIV challenge with the synthetic HIV-1 Tat Oyi vaccine" doc
Báo cáo y học: " Reservoir cells no longer detectable after a heterologous SHIV challenge with the synthetic HIV-1 Tat Oyi vaccine" doc
... i.m.)Antibody response against Tat for the seven macaques vacci-nated with Tat OyiFigure 4Antibody response against Tat for the seven macaques vacci-nated with Tat Oyi. The 965 (white square), 966 (no ... viremia comparedto control macaques and an increase of CD8 T cells was observed only on Tat Oyi vaccinatedmacaques. Reservoir cells were not detectable at 56 days post -challenge in all Tat Oyi vaccinatedmacaques ... human cells at the day of challenge and each week afterwards and allow to estimate the level of reservoir cells (Fig 2). Five on seven Tat Oyi Viral load of rhesus macaques vaccinated with Tat Oyi...
- 10
- 310
- 0
Báo cáo Y học: Baboon cytochrome P450 17a-hydroxylase/17,20-lyase (CYP17) Characterization of the adrenal microsomal and cloned enzymes docx
... the metabolitesindicating that the 1 7a- hydroxylase activity was consider-ably higher than the 21-hydroxylase activity. Typical HPLCanalyses of PROG metabolites present in the medium at 4and ... pregnenolone. No 1 6a- hydroxylase and no lyase activity for 1 7a- hydroxyprogesterone. Sequence ana-lyses showed that there are 28 different amino acid residuesbetween human and baboon CYP17, primarily ... andprogesterone and the C17,20-side chain cleavage (lyase) of1 7a- hydroxypregnenolone, necessary for the biosynthesis ofC21-glucocorticoids and C19-androgens, but also catalyses the 1 6a- hydroxylation...
- 9
- 420
- 0
Báo cáo y học: "Molecular characterization of partial-open reading frames 1a and 2 of the human astroviruses in South Korea" doc
... ORF1b, and ORF2,which encode a serine protease, an RNA-dependentRNA polymerase, and a structural protein, respectively[1,2]. AstVs are known to infect humans as well as a variety of mammalian and ... SE0510110, and SE0412021, also forme d a large genogroup in the analysis of the partial ORF 1a (Fig. 1). In contrast, B elliot et al. (1997) reported thatsuch genotype was not found in their analysis ... Korea) and weresequenced using ABI 3730XL DNA Analyzer (AppliedBiosystems, Carlsbad, CA).Multiple alignment and phylog enetic analysis wereconducted using the ClustalX program and the PHYLIPpackage....
- 5
- 414
- 0
Báo cáo y học: " Does unrestrained single-chamber plethysmography provide a valid assessment of airway responsiveness in allergic BALB/c mice?" doc
... Nakagome K, Dohi M, Okunishi K, Komagata Y, Nagatani K, TanakaR, Miyazaki J, Yamamoto K: In vivo IL-10 gene delivery sup-presses airway eosinophilia andhyperreactivity by down-reg-ulating APC ... contrast toasthma, nonasthmatic eosinophilic bronchitis is not asso-ciated with variable airflow limitation or airway hyperre-sponsiveness [29]. Another explanation may be thatinhalation ... upper airway resistance and it could reflect airflowlimitation in the upper airway, including the nasal cavity,larynx and pharynx, etc. As we know, in humans, nasalresistance contributes about...
- 11
- 520
- 0
Báo cáo y học: "Comprehensive evaluation of genetic variation in S100A7 suggests an association with the occurrence of allergic rhinitis" pptx
... Germany. The genotype data for rs3014837 wasalso analyzed using a Taqman assay (Custom TaqMan®SNP Genotyping Assay ID C_736084_10, Applied Biosys-tems), on an ABI 7900 HT system. An 8-nucleotide ... which is the highestnumber of minor alleles of any haplotype appearing in the analysis.Association between genotype in patients and SPT results The Kruskall-Wallis non-parametric test was used ... using mass-spec-trometry. Assay design was made using the MassARRAYAssay Design ver. 2.0 software (Sequenom Inc, USA).Primers (Additional file 1) were obtained from MetabionGmbH, Germany. The...
- 7
- 267
- 0
Báo cáo y học: "Comparison of cough reflex sensitivity after an inhaled antigen challenge between actively and passively sensitized guinea pigs" pdf
... naika-k1@kinbyou.hosp.go.jp; Nobuyuki Katayama - nobu-katabon@guitar.ocn.ne.jp; Miki Abo - abo@med3.m.kanazawa-u.ac.jp; Noriyuki Ohkura - nori@med3.m.kanazawa-u.ac.jp; Yoriko Herai - herai@med3.m.kanazawa-u.ac.jp; Akihiro ... Herai, Akihiro Hori, Yoshihisa Ishiura, Kouichi Nobata, Haruhiko Ogawa, Masahide Yasui, Kazuo Kasahara and Shinji NakaoAddress: Respiratory Medicine, Cellular Transplantation Biology, Kanazawa ... guineapigs.MethodsAnimalsMale, albino, Hartley-strain guinea pigs were obtainedfrom Sankyou Laboratory Service (Toyama, Japan). Theywere quarantined in the Animal Research Center ofKanazawa University. All the animal...
- 8
- 263
- 0
Báo cáo y học: " Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency" docx
... viral reactivation after treatment of U1 and ACH-2 cells with NaBFigure 1Analysis of viral reactivation after treatment of U1 and ACH-2 cells with NaB. U1 and ACH-2 cells were treated or not ... wild-type(AGGGACTTGAAAGCGAAAGGGAAACCAGAG) ormutated (AGGGACTTGCCCGCGCCCGGGAAACCA-GAG) synthetic oligonucleotide corresponding to the HIV-1 BRU ISRE sequence (nt +194 to +223) [33,53] in the ... may contribute to the maintenanceof the latent state in the promonocytic cell line. Implication of these factors in the maintenance orreactivation of the viral latency may provide potential...
- 14
- 315
- 0
Báo cáo y học: "Deafblindness in French Canadians from Quebec: a predominant founder mutation in the USH1C gene provides the first genetic link with the Acadian population" ppsx
... c.216G> ;A and another mutation, only the c.216G> ;A- associated haplotype is shown. Recombination events are indicated by grey background. Acadian: for comparison of the c.216G> ;A- associated haplotype ... haplotype ('Acadian allele') with haplotypes in our sample, we have genotyped the family of a previously described patient with homozygosity for c.216G> ;A (see Additional data file 1a) . ... French Canadian, Acadiawas founded four years prior to Quebec and in a geographi-cally separate area now corresponding to New Brunswick andNova Scotia. Acadians to a great extent came from...
- 8
- 271
- 0
Báo cáo toán học: "Minimum rank of matrices described by a graph or pattern over the rational, real and complex numbers" doc
... elimination (when available) allows one to verify the validity of statements of the form that appear in (a) -(e). Over the complex numbers, the insolvability of a systemof polynomial equations and ... Preprint. Available athttp://arxiv.org/pdf/math.CO/0701562.[KR] Swastik Kopparty, K. P. S. Bhaskara Rao .The Minimum Rank Problem: a counterexample. Presentation at the 14th International Linear Algebra ... minimum rank. For example, a matrix associated with a path on n vertices (Pn) is a symmetric tridiagonal matrix with nonzero sub- and super-diagonal, and thus has minimum rank n − 1, whereas the...
- 19
- 238
- 0
Báo cáo y học: " Open Access No evidence of altered alveolar macrophage polarization, but reduced expression of TLR2, in bronchoalveolar lavage cells in sarcoidosis" doc
... erythema nodosum and/or anklearthritis, fever and bilateral hilar lymph adenopathy with or without parenchymal infiltration, are characterized byan acute onset and a good prognosis and usually ... between patient subgroups (with and withoutLöfgren’s syndrome), and healthy subjects. In the case of a statistically significant result in the ANOVA, statisticalcomparisons were made by use of the ... healthy controls for bronchoalveolarlavage obtaining a desired match with patients for fac-tors such as smoking history and age is not practicallyfeasible. Also, the above mentioned study was...
- 13
- 216
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcmai hồng bàng và cộng sự 2006 đặc điểm siêu âm siêu âm doppler màu và giá trị của nó trong chẩn đoán ung thư biểu mô tế bào gan y học việt nam số đặc biệt 329 tr 189 195báo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ