Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
Báo cáo y học: " Use of the novel hemostatic textile Stasilon® to arrest refractory retroperitoneal hemorrhage: a case report" pps
... composed of fiberglass and bamboo yarns incorporated into a proprietary weave. It hasbeen cleared by the United States Food and Drug Administration for external and internal use and has been granted ... of an array of potentially hemostatic textile materials and it has been cleared for bothexternal and internal use by the United States Food and Drug Administration for the arrest of hemorrhage. ... quadrant. Electrocautery and suture ligationwere ineffective and the abdomen was repacked withcotton laparotomy pads and the abdomen left open.Mesenteric ang iography was performed after failure...
- 5
- 389
- 0
Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt
... R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG and R5-TM-R, AATTCCTATTCTATATATACTATGGTCCACACGACTATT-GCTATGATTAGTGCTA CTATCAATGCTCCTACTC-CTAATTTATAATCTAAATTTAACATCTC. The cytoplasmicdomains were ... NL-TM-R,AATTCCTATTCTATGATTACTATGGACCACACAGCTATTGCTATTATTATTGCTACTACTAATGCTACTATTGCTAC-TATTATAGGTTGCATCTC; for the R5 vpu TM region, R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG ... GAATTCACTACAGATCATCAATATCCCAAG; for the R5 vpu gene, Vpu-R5-F, GGATCCATGTTAAATTTA-GATTATAAATTAGGAGTA GG and Vpu-R5-R, GAAT-TCATTACAAATCATTAACATCCAAAAGCC. The amplifiedfragments designated as NL vpu and...
- 11
- 436
- 0
Báo cáo y học: " Production of infectious human immunodeficiency virus type 1 does not require depletion of APOBEC3G from virus-producing cells" pdf
... (A & D) and a Vif monoclonal antibody (B & E) as in figure 2 and analyzed on a confocal microscope. Panels C & F are overlays of panels A & B and D & E, respectively. Arrow ... E) anti-Vif MAb #319 + anti-Myc polyclonal antibody; (C & F) anti-Vif MAb #319 + anti-APO3G polyclonal antibody. Vif was visualized using Cy2-conjugated secondary antibodies (green) and APOBEC3G ... was used for all immunoblotanalyses and some of the immunohistochemical analysesas indicated in the text and was obtained from MichaelMalim through the NIH AIDS Research and ReferenceReagent...
- 12
- 279
- 0
Báo cáo y học: " Identification of restriction endonuclease with potential ability to cleave the HSV-2 genome: inherent potential for biosynthetic versus live recombinant microbicides" pdf
... needed. For instance,the P23 promoter from Lactococcus lactis created by PCRamplification with the primers 5'-GTGGAGCTC-CCCGAAAAGCCCTGACAACCC-3' and 5'-GGAAACACGCTAGCACTAACTTCATT-3', ... Savvy (C31G) [28]; and plant derivative like Pra-neem polyherbal suppository and gossypol may serve thepurpose. Note that meta-analysis of randomized control-led trials including more than ... recombinant microbicidesMisaki Wayengera*1,2,3,4, Henry Kajumbula1,3 and Wilson Byarugaba1,4Address: 1Restrizymes Biotherapeutics Uganda Limited, Kampala, Uganda, 2Restrizymes Corporation-...
- 12
- 376
- 0
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
... this article as: Lewis et al.: Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence ... RESEA R C H Open Access Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence ... Act and The Guide for the Care and Use of Laboratory Animals, as well as according to animal carestandards deemed acceptable b y the Association for theAssessment and Accredi tation of Laboratory...
- 19
- 317
- 0
Báo cáo y học: " Response of pulmonary artery intimal sarcoma to surgery, radiotherapy and chemotherapy: a case report" docx
... survival of patients and therapies such as chemother-apy and radiotherapy may also contribute to the manage-ment of this disease, and where appropriate should berecommended. In addition, systematic ... still not clearly defined. The sameis true for radiation therapy and postoperative anticoagu-lation therapy [8]. The prognosis of PA intimal sarcoma ispoor, and survival is usually 12 to 18 months ... theincidence of aortic intimal sarcoma. The mean age of patients diagnosed with PA intimal sarcoma is 48 years,while the mean age of patients at diagnosis of aortic inti-mal sarcoma is 62 years [3,4].PA...
- 3
- 282
- 0
Báo cáo y học: "Response of the mouse lung transcriptome to welding fume: effects of stainless and mild steel fumes on lung gene expression in A/J and C57BL/6J mice" pot
... theIPA analysis and drafted the manuscript. MLK and SL were responsible for thestatistical design, data management, statistical analysis and clustering analysis for these studies. JMA and PCZE ... light/12 hourdark) at a standard temperature (22-24°C) and 30-70%relative humidity. Animals were acclimated to the animal facility for a minimum of 1 week and allowed access to a conventional diet ... Pathology and Physiology Research Branch, National Institute for Occupational Safety and Health, Morgantown, 26505, USA and 2Health Effects Laboratory Division, Biostatistics and Epidemiology Branch,...
- 18
- 382
- 0
Báo cáo y học: "Risk of acute myocardial infarction with nonselective non-steroidal anti-inflammatory drugs: a meta-analysis" ppsx
... anti-inflammatoryagents, non steroidal anti-inflammatory) and AMI (for instance,myocardial infarction, myocardial ischemia, cardiac ischemia,death) were combined to capture all potentially ... non-steroidal anti-inflammatory drugs: a meta-analysisGurkirpal Singh1,2, Olivia Wu3, Peter Langhorne4 and Rajan Madhok51Division of Gastroenterology and Hepatology, Stanford University School ... anti-inflammatory drugs(NSAID) and aspirin for preventing colorectal adenomas and carcinomas. Cochrane Database Syst Rev 2004, 2:CD004079.8. Cryer B, Feldman M: Cyclooxygenase-1 and cyclooxygenase-2selectivity...
- 9
- 279
- 0
Báo cáo y học: " Impact of concomitant DMARD therapy on adherence to treatment with etanercept and infliximab in rheumatoid arthritis. Results from a six-year observational study in southern Sweden" docx
... co-morbidities at treatment initiation for the infliximab and the etanercept groups. Patients initiatingtherapy were checked for an up -to- 10-year prior history of car-diovascular diseases, any malignancies, ... infliximab, etanercept, as well as adalimumab werewidely available (Figure 1). The number of biologic-naïvepatients starting adalimumab was too limited to allow mean-ingful analysis, and patients ... that patients who tolerate MTX well also are likely to tol-erate TNF-blocking agents. Thus, tolerance to MTX therapymay be used as a surrogate measure for potential high tolera-bility of anti-TNF...
- 10
- 502
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenevaluation of a combined treatment with iron sucrose and erythropoietin alpha predictors of response efficacy and safetyfuture application of integrative therapies for sepsis bench and experimental animal modelsbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM