Báo cáo khoa học: "Conserved positive selection signals in gp41 across multiple subtypes and difference in selection signals detectable in gp41 sequences sampled during acute and chronic HIV-1 subtype C infection" potx

... JournalOpen AccessResearchConserved positive selection signals in gp41 across multiple subtypes and difference in selection signals detectable in gp41 sequences sampled during acute and chronic HIV-1 ... hypothesis we compared selection signals detectable by various methods in the subtype- C acute infection (AI) and chronic infection (CI) gp41 datasets in the context of selection signals detectable in datasetsdrawn ... broadly neutralizing antibodies such as 4E10 and 2F5 that target gp41. Differences in the selection signals detectable in sequences sampled during acute and chronic HIV infectionsIt is probable...

Báo cáo khoa học: Rapamycin inhibits lipopolysaccharide induction of granulocyte-colony stimulating factor and inducible nitric oxide synthase expression in macrophages by reducing the levels of octamer-binding factor-2 doc

... ACTTGGGATGCTCCATGGTCMouse G-CSF Forward CTCAACTTTCTGCCCAGAGGReverse CTGGAAGGCAGAAGTGAAGGHuman G-CSF Forward CACTCTGGACAGTGCAGGAAGReverse CGACACCTCCAGGAAGCTCTGGAPDHaForward AAAGGATCCACTGGCGTCTTCACCACCReverse ... ForwardACGCGTAGATCCAACACCCTGCAGCGATReverseAGATCTGATTCTGGGTGATCTGGGCTGCAOligonucleotides used for RT-PCROct-2aForward AATGGACCCGACATTAACCAReverse AAATGGTCGTTTGGCTGAAGiNOSaForward AGGAACATCTGGCCAGGCTGReverse ... AACTGGGGACTCTCCCTTTGReverse CTACTCCGTGAAGTGAACAAaPrimers that can be used to amplify both human and mouse Oct-2, iNOS and GAPDH cDNA.Y Y. Chou et al. Rapamycin inhibits LPS-induced G-CSF and iNOS...

Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

... as-GIHF-SalI(5¢-CGGTCGACAACATCCTGGACAGCA-3¢) and as-GIHR-BamHI (5¢-CGGGATCCTCACCACGGCCGGCCGGC-3¢). The antisense template was ﬁrst cloned intopET17b vector at BamHI and XhoI sites, following by thesense ... after incubatingwith GIH-dsRNA. This silencing was not affected byirrelevant dsRNA, thus indicating that Pem-GIHknockdown occurred in a sequence-speci c fashion.Similar speci c silencing of ... reproductivecycle and homogenized in TRI-REAGENTÒ(MolecularResearch Center, Cincinnati, OH, USA). Total RNA ofeyestalks was extracted by using TRI-REAGENTÒaccord-ing to instructions of...

Báo cáo khoa học: "Why Initialization Matters for IBM Model 1: Multiple Optima and Non-Strict Convexity" pptx

... al.’s claim is in fact incorrect. Furthermore, we willempirically show in Sections 4 and 5 that multiple distinct pa-rameter values can achieve the global optimum of the objectivefunction, which ... 2002.Object recognition as machine translation: Learning alexicon for a ﬁxed image vocabulary. In Proceedingsof ECCV.Volker Kaibel, Marc E. Pfetsch, and TU Berlin. 2002.Some algorithmic problems in ... negativelog-likelihood objective is convex but not strictlyconvex and thus the overall objective is convex, butnot strictly convex. Because the objective is con-vex, the inequality constraints are convex, and theequality...

Báo cáo khoa học: " Comparison of a small volume of hypertonic saline solution and dextran 40 on hemodynamic alternations in conscious calves" ppsx

... mmHg/l/min) and pulmonary vascular resistance (PVR: [PAP/CO] × 80,mmHg/l/min) were calculated [14].Venous samples were collected at each recording point and used to determine hemoglobin concentration ... addition, CO remained higher in the treatment with D40than that with Lactated Ringer’s [10]. In the present, D40infusion induced significant increases in CO, CI and SV,reaching 14.7 ± 2.9 l/min, ... hypertonic infusion in the treatment of experimental shock in calves and clinicalshock in dogs and cats. Vet Rec 1993. 133, 585-590.4. Griffel MI, Kaufman BS. Pharmacology of colloids and crystalloids....

Báo cáo khoa học: "Treatment results for hypopharyngeal cancer by different treatment strategies and its secondary primary- an experience in Taiwan" pptx

... tract(including oral cavity, pharynx, esophagus and lung) isthe most common cancer that occurs in Taiwaneseman, and the incidence of oral cavity cancer and eso-phageal cancer is increasing ... Taiwan.7Graduate Institute of ClinicalMedical Science, Chang Gung University, Taoyuan, Taiwan.Authors’ contributionsMFC and JTC designed and coordinated the study. Patient accrual and clinical data collection ... oropharynx carcinoma. J Natl Cancer Inst 1999, 91:2081-2086.16. Wang HM, Wang CS, Chen JS, Chen IH, Liao CT, Chang TC: Cisplatin,tegafur, and leucovorin: a moderately effective and minimally toxicoutpatient...

báo cáo khoa học: "A cytogenetic survey was carried out on fattening male and female pigs of different lines in a local herd and on " ppsx

... monocentric translocation occurredearlier in the Landrace of GDR. The increased local use of an aberrant boar in artificial insemination can lead to higher frequency, as ... translocation in swineM. SCHWERIN,D. GOLISCHE. RITTERResearch Centre of Animal ProductionDummerstorf-Rostock, 2551 DummerstorfGerman Democratic RepublicSummaryA cytogenetic survey ... probably is present only in the Landrace boars of GDR, and therefore occurs in this race more frequently. Considering its distribution and C- banding pattern, it may be...

Báo cáo khoa học: Conserved residues in the N-domain of the AAA+ chaperone ClpA regulate substrate recognition and unfolding pdf

... manner. In contrast to theFig. 1. Multiple sequence alignment of the N-domain of bacterial ClpA homologues and E. coli ClpB. Amino acid sequences of the N-domainof ClpA from E. coli (P0ABH9), V. cholera ... twoelements in ClpA, one in the N-domain and the other in the pore of the ClpA hexamer. In the case of shortunstructured peptides or unfolded proteins such ascasein, binding to the tyrosine residues in ... dWB and RR ⁄ dWB to interact with FITC-casein. As a control, in the absence of ClpA,FITC-casein eluted in a single peak at 21.5 mL(Fig. 4A, open circles). However, upon addition ofATP and...

Báo cáo khoa học: Conserved structural determinants in three-ﬁngered protein domains pdf

... CAa1CBa1,CAa2CBa1,CAa1CBa2 and CAa2CBa2, where CAa1is thea-carbon of the N-terminal cysteine residue in cystine A,CBa1is the same atom in the N-terminal cysteine residue in cystine ... speci c to cer-tain classes of TFPD (Fig. 2), such as B2a whichoccurs in long neurotoxins and B3a which is found in Act-RII. B1a is a more common feature and can beseen in both ligands, such ... atomicinteractions can also be seen between domains I, II and III.Deeper analysis of the interaction clustersUsing distance matrices, speci c intramolecular inter-action networks and calculated...

Báo cáo khoa học: Conserved pore-forming regions in polypeptidetransporting proteins pot

... of motif 3 (A,B) and motif 4 (C, D) were calculated according to [11]. The valuesof the region including the 10 amino acids in front and behind themotifs are shown. Black lines show the average ... the fraction of random strings that havematch scores bigger or equal than the score of theputative motif in the target sequence. The threshold toselect sequences containing a speci c motif ... appearance ofa motif with a score better than the threshold onceevery 1000 sequences randomly generated using thesame amino acid frequency as in the sequence pool.According to these limits we conclude...

Xem thêm