Rapamycin inhibits lipopolysaccharide induction of granulocyte-colony stimulating factor and inducible nitric oxide synthase expression in macrophages by reducing the levels of octamer-binding factor-2 Yuan-Yi Chou1, Jhen-I Gao1, Shwu-Fen Chang2, Po-Yuan Chang3 and Shao-Chun Lu1 Department of Biochemistry and Molecular Biology, College of Medicine, National Taiwan University, Taipei, Taiwan Graduate Institute of Medical Sciences, Taipei Medical University, Taiwan Department of Internal Medicine, National Taiwan University Hospital, National Taiwan University, Taipei, Taiwan Keywords granulocyte-colony stimulating factor (G-CSF); inducible nitric oxide synthase (iNOS); lipopolysaccharide (LPS); macrophage; mammalian target of rapamycin (mTOR); octamer-binding factor-2 (Oct-2); rapamycin Correspondence S.-C Lu, Room 810, No.1, Jen Ai Road Section 1, Department of Biochemistry and Molecular Biology, College of Medicine, National Taiwan University, Taipei 10051, Taiwan Tel: +886 2312 3456, ext 88224 Fax: +886 2391 5295 E-mail: lsc@ntu.edu.tw Website: http://www.mc.ntu.edu.tw/ department/ibmb/ (Received 22 July 2010, revised October 2010, accepted 21 October 2010) doi:10.1111/j.1742-4658.2010.07929.x This article reports an inhibitory effect of rapamycin on the lipopolysaccharide (LPS)-induced expression of both inducible nitric oxide synthase (iNOS) and granulocyte-colony stimulating factor (G-CSF) in macrophages and its underlying mechanism The study arose from an observation that rapamycin inhibited the LPS-induced increase in octamer-binding factor-2 (Oct-2) protein levels through a mammalian target of rapamycin (mTOR)dependent pathway in mouse RAW264.7 macrophages As both iNOS and G-CSF are potential Oct-2 target genes, we tested the effect of rapamycin on their expression and found that it reduced the LPS-induced increase in iNOS and G-CSF mRNA levels and iNOS and G-CSF protein levels Blocking of mTOR-signaling using a dominant-negative mTOR expression plasmid resulted in inhibition of the LPS-induced increase in iNOS and G-CSF protein levels, supporting the essential role of mTOR Forced expression of Oct-2 using the pCG–Oct-2 plasmid overcame the inhibitory effect of rapamycin on the LPS-induced increase in iNOS and G-CSF mRNA levels Chromatin immunoprecipitation assays showed that LPS enhanced the binding of Oct-2 to the iNOS and G-CSF promoters and that this effect was inhibited by pretreatment with rapamycin Moreover, RNA interference knockdown of Oct-2 reduced iNOS and G-CSF expression in LPS-treated cells The inhibitory effect of rapamycin on the LPS-induced increase in Oct-2 protein levels and on the iNOS and G-CSF mRNA levels was also detected in human THP-1 monocyte-derived macrophages This study demonstrates that rapamycin reduces iNOS and G-CSF expression at the transcription level in LPS-treated macrophages by inhibiting Oct-2 expression Introduction Macrophages play a critical role in the host defense against bacterial pathogens The toll-like receptor (TLR4) on the surface of macrophages recognizes lipopolysaccharide (LPS), a Gram-negative bacterial endotoxin, and induces the production of proinflammatory cytokines [1,2] In LPS-stimulated macrophages, Abbreviations Akt-in, Akt inhibitor; ChIP, chromatin immunoprecipitation; DN, dominant-negative; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; G-CSF, granulocyte-colony stimulating factor; iNOS, inducible nitric oxide synthase; LPS, lipopolysaccharide; mTOR, mammalian target of rapamycin; NO, nitric oxide; Oct-1, octamer-binding factor-1; Oct-2, octamer-binding factor-2; PI3K, phosphoinositide 3-kinase; PMA, 4b-phorbol 12-myristate 13-acetate; RR, rapamycin-resistant; TLR4, toll-like receptor 4; TSA, trichostatin A FEBS Journal 278 (2011) 85–96 ª 2010 The Authors Journal compilation ª 2010 FEBS 85 Rapamycin inhibits LPS-induced G-CSF and iNOS expression Y.-Y Chou et al gene expression is controlled by the activation of various protein kinases, such as protein kinase A, protein kinase C, Src-related kinases, mitogen-activated protein kinases and phosphoinositide 3-kinase (PI3K), downstream of the TLR4-signaling pathway [3–5] Of the LPS-induced genes, those coding for inducible nitric oxide synthase (iNOS) and granulocyte-colony stimulating factor (G-CSF) attracted our interest, because both proteins are important in the host’s defense against microbial infection iNOS catalyzes the production of nitric oxide (NO) to combat invading pathogens [6] and G-CSF stimulates the production, growth and function of neutrophils [7,8] Both iNOS and G-CSF genes are expressed in macrophages and their expression is strongly induced by LPS at the transcriptional level [9–11] In addition, a nuclear factorkappa B-binding element, a nuclear factor-interleukin-6 (also named C ⁄ EBPb)-binding element and an octamer element in the promoter of the iNOS and G-CSF genes have been reported to be essential for full promoter activities of these two genes following stimulation with LPS [9,10,12,13] However, there is clinical evidence that excessive concentrations of NO or G-CSF exacerbates inflammatory responses and causes tissue damage [14,15] It is therefore necessary to maintain appropriate levels of both iNOS and G-CSF during inflammation, and the expression of these two genes should be tightly controlled and regulated by similar mechanisms Activation of PI3K leads to the production of phosphatidylinositol 3,4-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate [16,17], which subsequently activate downstream signaling molecules, such as Akt [18] and mammalian target of rapamycin (mTOR), regulating various biological processes, including cell cycling, cell survival and protein synthesis [19] There is growing evidence that mTOR (activated by TLR4 via PI3K ⁄ Akt) is crucial in monocytes and macrophages for coordinating the innate immune response, but how mTOR exerts its effect is poorly understood [20,21] A well-known function of mTOR is to regulate protein synthesis by activating p70 S6 kinase and by inhibiting eukaryotic translation initiation factor 4E-binding protein (eIF4E-BP1) [19] Rapamycin, a potent immunosuppressor, exerts its function by binding to the FK506-binding protein (FKBP12) and inhibits the activity of mTOR complex (mTORC1) and subsequently inhibits the translation of target mRNA, but has no effect on mTOR complex (mTORC2) [22] In contrast, in LPS-stimulated innate immune cells, rapamycin alters the expression of cytokine genes at the transcriptional level [21], and LPS-induced expression of iNOS in macrophages has been reported to be partially 86 inhibited by rapamycin at the mRNA level [23] These findings suggest that mTOR may be involved in gene expression through mechanisms other than translational control Octamer-binding factor-2 (Oct-2) is a transcription factor that binds to the octamer element (ATGCAAAT) in the promoter of its target gene We have previously demonstrated that expression of Oct-2 can be induced by LPS in macrophages and that it is involved in the LPS-induced upregulation of resistin and iNOS expression [24,25] In addition, we reported that treatment of macrophages with LY294002 decreased LPS-induced Oct-2 expression at the protein level, subsequently reducing the expression of resistin [24] As LY294002 inhibits the activity of both PI3K and mTOR [26], we speculated that the induction of Oct-2 expression by LPS might occur through an mTORdependent pathway and be inhibited by the mTOR inhibitor, rapamycin In addition, Oct-2 is involved in the expression of LPS-inducible genes that contain octamer in their promoters [24,25] Thus, rapamycin may inhibit the expressions of iNOS and G-CSF at the transcriptional level in LPS-treated macrophages In this study, the effects of rapamycin on the LPSinduced increase in Oct-2 protein and on the expression of iNOS and G-CSF protein and mRNA were evaluated in macrophages, and the involvement of Oct-2 in LPS ⁄ mTOR-induced iNOS and G-CSF expression was investigated further Results Rapamycin inhibits the LPS-induced increase in Oct-2 protein levels in RAW264.7 macrophages Oct-2 mRNA and Oct-2 protein levels increased in a time-dependent manner when RAW264.7 cells were exposed to LPS for to 24 h Oct-2 mRNA levels increased by 60% at h and reached a maximum, of about threefold higher than the basal level, after 4–8 h of stimulation with LPS, then showed a subsequent decrease at 24 h (Fig 1A, upper panel) Oct-2 protein levels showed an 80% increase at h, reached a maximum of about 10-fold higher than the basal level at h and were maintained at this level for at least 24 h (Fig 1A, bottom panel) To confirm that the LPSinduced increase in Oct-2 protein was inhibited by the PI3K inhibitor LY294002 [24], the cells were treated with 12.5, 25 or 50 lm LY294002 for 30 before, and during, treatment with LPS for h Fig 1B shows that LY294002 inhibited the LPS-induced increase in Oct-2 protein levels in a dose-dependent manner, reaching  70% inhibition at 50 lm LY294002 A similar, but lower, inhibitory effect on the LPS-induced FEBS Journal 278 (2011) 85–96 ª 2010 The Authors Journal compilation ª 2010 FEBS Y.-Y Chou et al Rapamycin inhibits LPS-induced G-CSF and iNOS expression A B C Oct-2 GAPDH 0 25 50 75 Oct-2 β-actin LY (μM) 24 12.5 25 50 Akt-in (μM) LPS Time (h) E LPS F Oct-2 β-actin LPS LY Oct-2 β-actin Oct-2 Oct-2 * β-actin D β-actin Oct-2 LPS Oct-2 GAPDH LPS Vector DN-Akt LPS LY Akt-in β-actin LPS Akt-in Fig LPS induces the expression of Oct-2 mRNA and Oct-2 protein in RAW264.7 macrophages, and the induction of Oct-2 protein by LPS is blocked by a PI3K or an Akt inhibitor (A) RAW264.7 cells were treated with 100 ngỈmL)1 of LPS for 0, 1, 2, 4, or 24 h, then the levels of Oct-2 mRNA (upper panels) or Oct-2 protein (lower panels) were determined by RT-PCR or western blot analysis, respectively GAPDH or b-actin was used as the respective internal control The asterisk indicates a nonspecific signal (B and C) RAW264.7 cells were untreated (lane 1), were treated with LPS for h (lane 2), or were pretreated for 30 with increasing concentrations of LY294002 (B) or Akt-in (C) before treatment with LPS (100 ngỈmL)1) for h (lanes 3–5); the levels of Oct-2 and b-actin were then measured by western blotting (D) RAW264.7 cells were untreated (lanes and 2) or were pretreated with 50 lM LY294002 (upper panels) or 50 lM Akt-in (lower panels) for 30 (lanes and 4), then incubated with (lanes and 4) or without (lanes and 3) LPS for h The Oct-2 and b-actin levels were measured by western blotting (E) Cells were transiently transfected with 7.5 lg of empty vector or DN-Akt expression plasmid, then, after 24 h, were incubated for h in the presence or absence of LPS and the levels of Oct-2 and b-actin were analyzed by western blotting (F) Cells were untreated (lane 1) or were treated for h with LPS in the absence (lane 2) or presence of 25 lM LY294002 (lane 3) or 50 lM Akt-in (lane 4), then the Oct-2 and GAPDH mRNA levels were analyzed by RT-PCR The results are representative of three independent experiments LY, LY294002 Oct-2 protein increase was also seen in cells treated with 0.5 lm wortmannin, another PI3K inhibitor (data not shown) As Akt is a well-characterized downstream effecter of the PI3K signaling pathway, we examined whether it is involved in the LPS-induced increase in Oct-2 protein Pretreatment with 25, 50 or 75 lm Akt inhibitor (Akt-in) before treatment with LPS for h resulted in a dose-dependent decrease in Oct-2 protein, with maximal inhibition (approximately 70%) being achieved using 50 or 75 lm Akt-in (Fig 1C) Inhibitors (LY294002 and Akt-in) had no effect on Oct-2 expression in cells not stimulated with LPS (Fig 1D) To further evaluate the involvement of Akt in the LPS-induced increase of Oct-2 protein, RAW264.7 cells were transfected with the dominant-negative (DN)-Akt expression plasmid for 24 h before h of stimulation with LPS, and this resulted in a reduction of about 60% in Oct-2 protein expression compared with cells not treated with the expression plasmid (Fig 1E) However, the levels of Oct-2 mRNA were not altered by either LY294002 or Akt-in in LPS-treated cells (Fig 1F) These results show that LPS upregulates Oct-2 protein in macrophages through a PI3K ⁄ Akt-dependent pathway As mTOR is one of several downstream targets of PI3K and because LY294002 is also an mTOR inhibitor [26], it is possible that mTOR is also involved in LPS-induced Oct-2 expression To test this possibility, cells were pretreated with increasing amounts of rapamycin before treatment with LPS and then the expression of Oct-2 was analyzed Fig 2A shows that rapamycin inhibited the increase in Oct-2 protein levels in LPS-treated cells in a dose-dependent manner, whereas the Oct-2 mRNA levels in LPS-treated cells were not affected (Fig 2C) Rapamycin had no effect on Oct-2 expression in cells not stimulated with LPS (Fig 2B) To verify the involvement of mTOR in LPS-induced Oct-2 expression, RAW264.7 cells were transfected with either the DN-mTOR expression plasmid or the rapamycinresistant (RR)-mTOR expression plasmid 24 h before FEBS Journal 278 (2011) 85–96 ª 2010 The Authors Journal compilation ª 2010 FEBS 87 Rapamycin inhibits LPS-induced G-CSF and iNOS expression A Y.-Y Chou et al B 4 LPS Oct-2 3.0 2.5 2.0 1.5 1.0 0.5 0.0 LPS LPS Rapa 100 200 400 E F GAPDH β-actin Rapa (ng·mL–1) Oct-2 Relative Oct-2 mRNA (Oct-2/GAPDH) β-actin D Oct-2 Oct-2 C Oct-2 Rapa 4 p-p70S6K β-actin β-actin p70S6K LPS LPS Rapa LPS Vector DN-mTOR Control Rapa RR-mTOR Vector DNmTOR Fig Rapamycin reduces the LPS-induced increase in Oct-2 protein levels, but not in Oct-2 mRNA levels, in RAW264.7 macrophages through an mTOR-dependent pathway (A) RAW264.7 cells were untreated (lane 1), were treated with 100 ngỈmL)1 of LPS for h (lane 2) or were pretreated for 30 with increasing concentrations of rapamycin before LPS treatment for h (lanes 3–5); the concentrations of Oct-2 and b-actin were then measured after western blotting (B) RAW264.7 cells were untreated (lanes and 2), or were pretreated with 200 ngỈmL)1 of rapamycin for 30 (lanes and 4), followed by incubation with (lanes and 4) or without (lanes and 3) LPS for h The levels of Oct-2 and b-actin were measured after western blotting (C) RAW264.7 cells were untreated (lane 1), were treated with LPS for h (lane 2), or were pretreated for 30 with 200 ngỈmL)1 of rapamycin before LPS treatment for h, then the Oct-2 and GAPDH mRNA levels were measured by RT-PCR The levels of Oct-2 mRNA were normalized to those for GAPDH and the results were expressed relative to those in the untreated control (relative value = 1) The values are expressed as the mean ± sd of three independent experiments (D and E) RAW264.7 cells were transiently transfected with 7.5 lg of empty vector or plasmid encoding DN-mTOR (D) or RR-mTOR (E), then, 24 h later, were incubated for h with or without LPS in the absence or presence of 200 ngỈmL)1 of rapamycin; the Oct-2 and b-actin levels were analyzed after western blotting (F) RAW264.7 cells were untreated (lanes and 2) or were preincubated with 200 ngỈmL)1 of rapamycin for 30 (lane 3) or transiently transfected for 24 h with 7.5 lg of empty vector (lanes and 5) or plasmid encoding DN-mTOR (lane 6), then incubated in the presence or absence of LPS for 30 and the levels of total and phosphorylated p70 S6 kinase were determined by western blot analysis Similar results were obtained in three separate experiments Rapa, rapamycin treatment with LPS for h Transfection with the DN-mTOR expression plasmid inhibited the increase in Oct-2 protein in LPS-treated RAW264.7 macrophages by  60% (Fig 2D), while transfection with the RR-mTOR expression plasmid overcame the inhibitory effect of rapamycin on the increase in Oct-2 protein levels in LPS-treated cells (Fig 2E) The phosphorylation levels of p70 S6 kinase were assayed to verify the activation of mTOR Fig 2F shows that phospho-p70 S6 kinase was detectable after 30 of LPS treatment and that this effect was blocked by rapamycin treatment or by transfection with the DN-mTOR expression plasmid None of these treatments affected the total amount of p70 S6 kinase protein These results strongly suggest that mTOR activation is essential for LPS-induced Oct-2 protein expression Rapamycin decreases LPS-induced iNOS expression in RAW264.7 macrophages The octamer element plays an essential role in the LPS-induced activation of the promoters of the iNOS, 88 G-CSF and resistin [12,13,24,25] and we previously demonstrated that inhibition of Oct-2 expression by trichostatin A (TSA), a potent histone deacetylase inhibitor, or by LY294002 leads to reduced iNOS or resistin expression, respectively, in LPS-treated macrophages [24,25] It was possible that rapamycin might also reduce the expression of these genes We therefore tested the effect of rapamycin on the LPS-induced expression of iNOS and G-CSF Fig 3A shows that detectable levels of iNOS and G-CSF mRNAs were induced in RAW264.7 cells by h of incubation with LPS and that both effects were inhibited by pretreatment with rapamycin LPS-induced iNOS protein expression (4 h of incubation, Fig 3B) and nitrite production (24 h of incubation, Fig 3C) were also inhibited in cells pretreated with rapamycin Furthermore, DN-mTOR-transfected cells expressed only 46% as much iNOS protein as control cells in response to LPS (Fig 3D) and produced only 43% as much nitrite (Fig 3E) These results show that rapamycin inhibited LPS-induced iNOS expression in RAW264.7 macrophages through an mTOR-dependent pathway FEBS Journal 278 (2011) 85–96 ª 2010 The Authors Journal compilation ª 2010 FEBS Y.-Y Chou et al Rapamycin inhibits LPS-induced G-CSF and iNOS expression B iNOS C iNOS G-CSF 30 β-actin Nitrite (μM) A GAPDH LPS LY Rapa LPS Rapa LPS LPS + Rapa * 20 10 * D E 12 16 20 24 Time (h) iNOS β-actin LPS Nitrite induction (% of control) 100 Vector DN-mTOR 80 * 60 40 20 Vector DN-mTOR LPS Fig Rapamycin reduces LPS-induced NO production and the expression of iNOS mRNA and iNOS protein in RAW264.7 macrophages (A and B) RAW264.7 cells were either untreated or pretreated with LY294002 (50 lM) or rapamycin (200 ngỈmL)1) for 30 and then treated with LPS (100 ngỈmL)1) for h The levels of iNOS and G-CSF mRNAs (A) and the level of iNOS protein (B) were analyzed by RT-PCR and western blotting, respectively GAPDH mRNA or b-actin was used as the internal control Similar results were obtained in at least three independent experiments (C) Cells were treated with LPS in the absence or presence of 200 ngỈmL)1 of rapamycin for 0, 16 or 24 h, then the NO levels in the culture medium were determined using a Griess reagent system kit (D and E) RAW264.7 cells were transiently transfected with 7.5 lg of empty vector or DN-mTOR expression plasmid, then, after 24 h, were incubated for h (D) or 24 h (E) in the presence or absence of LPS; the levels of iNOS and b-actin were analyzed by western blotting (D) and the NO levels in the medium were determined using a Griess reagent system kit (E) The values for the LPS-treated cells were divided by those for the non-LPS-treated cells and are shown as a percentage of the values for the cells transfected with control vector (relative value = 100) All results are expressed as the mean ± SD of three independent experiments *P < 0.01 compared with the untreated control or the LPS-treated control, as appropriate LY, LY294002; Rapa, rapamycin Rapamycin inhibits G-CSF expression in LPS-treated RAW264.7 macrophages To examine whether LPS-induced G-CSF expression was also sensitive to rapamycin treatment, RAW264.7 cells were pretreated with rapamycin for 30 before treatment with LPS for different periods of time The levels of G-CSF mRNA (Fig 4A) and of G-CSF protein (Fig 4B) were below the detection limit in untreated cells and increased in a time-dependent manner in response to LPS stimulation Pretreatment with rapamycin resulted in approximately 50% less G-CSF protein in the medium (Fig 4B), which was probably caused by attenuation of G-CSF promoter activity (Fig 4C) and mRNA levels (Fig 3A) by rapamycin Transfection of RAW264.7 cells with the DN-mTOR expression plasmid also resulted in a reduction of about 50% in the LPS-induced increase in G-CSF protein in the medium (6 h of LPS treatment, Fig 4D), suggesting that activation of mTOR is essential for induction of G-CSF expression by LPS In a previous study, we showed that forced expression of Oct-2 restores iNOS protein levels in TSA- and LPS-treated cells [25] In the present study, ectopic expression of Oct-2 by transfection with increasing amounts of pCG-Oct-2 overcame the rapamycin-mediated inhibition of iNOS and G-CSF mRNA expression in LPStreated RAW264.7 cells in a dose-dependent manner (4 h of incubation; Fig 4E) These results confirm that Oct-2 plays a critical role in the upregulation of iNOS and G-CSF expression by LPS in RAW264.7 macrophages; moreover, these results also show that the LPS-induced increase in G-CSF expression is sensitive to rapamycin and suggest that mTOR activation is required for G-CSF expression in response to LPS Oct-2 is directly involved in LPS-induced iNOS and G-CSF expression in RAW264.7 macrophages To further examine the involvement of Oct-2 in LPSinduced iNOS and G-CSF gene expression in RAW264.7 cells, a chromatin immunoprecipitation (ChIP) assay was performed to examine the binding of Oct-2 to the iNOS and G-CSF promoters in vivo In FEBS Journal 278 (2011) 85–96 ª 2010 The Authors Journal compilation ª 2010 FEBS 89 Rapamycin inhibits LPS-induced G-CSF and iNOS expression B G-CSF GADPH LPS 12 Time (h) 24 C 400 300 G-CSF induction (% of control) * 200 100 D LPS LPS + Rapa 500 Relative luciferase activity (% of LPS treated) G-CSF in medium (ng·mL–1) A Y.-Y Chou et al E * * 12 Time (h) 100 80 60 40 20 24 LPS Rapa 0.2 1.0 0.5 1.0 1.4 1.7 Fold 1.0 0.5 0.7 0.9 1.1 Fold 0.2 100 * 1.0 0.4 0.7 0.9 1.3 Fold 0 iNOS 80 * 60 G-CSF 40 GAPDH 20 Oct-2 Vector DN-mTOR LPS β-actin pCG-Oct-2 (μg) LPS Rapa 0.2 0.4 0.6 Fig Rapamycin reduces LPS-induced G-CSF expression in RAW264.7 macrophages (A and B) RAW264.7 cells were untreated or were pretreated with rapamycin (200 ngỈmL)1) for 30 min, followed by treatment with 100 ngỈmL)1 of LPS for 0, 2, 4, 6, 8, 12 or 24 h (A) Total RNA was then isolated and the levels of G-CSF and GAPDH mRNAs were determined by RT-PCR The result is representative of those obtained in three similar experiments (B) The levels of G-CSF protein in the medium were determined by ELISA The values are the mean ± sd of an experiment performed in triplicate, and similar results were observed in three separate experiments (C) RAW264.7 cells were transfected with pG-CSF()283 ⁄ +35)-Luc and phRLTK, then, 24 h later, were pretreated with rapamycin and with LPS for h and the Photinus and Renilla luciferase activities were measured The levels of Photinus luciferase activity were normalized to Renilla luciferase activity and expressed relative to those in the LPS-treated controls (relative value = 100) (D) RAW264.7 cells were transfected and treated as in Fig 3E, except that LPS treatment was for h, then the G-CSF protein levels in the medium were determined by ELISA The values for the LPS-treated cells were divided by those for the non-LPS-treated cells and are shown as a percentage of the values for the cells transfected with control vector (relative value = 100) The values are the mean ± SD of three independent experiments *P < 0.01 compared with the untreated control or with the LPS-treated control, as appropriate (E) RAW264.7 cells were transfected with lg of control pCG vector or with increasing amounts of pCG–Oct-2 (made up to lg with pCG) and cultured for 24 h, then untreated (lane 1), treated with LPS for h (lane 2) or pretreated for 30 with 200 ngỈmL)1 of rapamycin, then treated with LPS for h (lanes 3–6); iNOS and G-CSF mRNA were detected by RT-PCR (upper panels) and Oct-2 protein in cell lysates was measured by western blotting (lower panels) GAPDH or b-actin was used as the respective internal control The results are representative of three independent experiments Rapa, rapamycin cells treated with LPS for h, but not in control cells, an iNOS promoter region from nucleotides )90 to 154 and a G-CSF promoter region from nucleotides )70 to )248, encompassing the octamer, were pulled down by anti-Oct-2 IgG (Fig 5), but not by a control IgG, and this effect was blocked by pretreatment with rapamycin This shows that Oct-2 binds to the iNOS and G-CSF promoters and that the binding is sensitive to rapamycin Moreover, specific knockdown of Oct-2 by transfection with an Oct-2 RNA interference (RNAi) plasmid (pLL3.7–Oct-2) resulted in decreased levels of iNOS protein in the cell lysate (4 h of incubation, Fig 6A) and G-CSF protein in the culture medium (6 h of incubation, Fig 6B) of LPS-induced cells These results support the critical role of Oct-2 in LPSinduced iNOS and G-CSF expression 90 LPS-induced expression of Oct-2, G-CSF and iNOS in the THP-1 human monocyte/macrophage cell line is sensitive to rapamycin treatment To determine whether rapamycin also inhibited Oct-2, iNOS, and G-CSF expression in human macrophages, THP-1, a human monocyte ⁄ macrophage cell line, was induced to differentiate by incubation with 160 nm 4b-phorbol 12-myristate 13-acetate (PMA) for 24 h, then the cells were treated with rapamycin and LPS (100 ngỈmL)1, h) As in mouse macrophages, Oct-2 protein expression was induced by LPS, and rapamycin inhibited this effect by 34% (Fig 7A) Moreover, rapamycin also inhibited the LPS-induced expression of iNOS and G-CSF mRNAs by 37% and 45%, respectively (Fig 7B) FEBS Journal 278 (2011) 85–96 ª 2010 The Authors Journal compilation ª 2010 FEBS Y.-Y Chou et al Rapamycin inhibits LPS-induced G-CSF and iNOS expression G-CSF promoter iNOS promoter Oct-2 Oct-2 IgG A β-actin Input LPS LY Akt-in Rapa LPS Rapa Fig Rapamycin inhibits the binding of Oct-2 to the iNOS and G-CSF promoters in LPS-treated RAW264.7 macrophages RAW264.7 cells were either untreated or pretreated with rapamycin for 30 and treated with or without LPS for h, then ChIP assays were performed using anti-Oct-2 IgG (top row) or control IgG (center row), and a 179 bp G-CSF promoter fragment ()248 to )70 bp) and a 244 bp iNOS promoter fragment ()90 to 154 bp) were amplified by PCR Ten per cent of the chromatin DNA used for immunoprecipitation was subjected to PCR and is indicated as ‘input’ (bottom row) The results are representative of three independent experiments Rapa, rapamycin A Oct -2 iNOS β-actin LPS Control RNAi LPS-induced G-CSF production (% of control) B Oct -2 RNAi B iNOS G-CSF GAPDH LPS Rapa Fig LPS induces Oct-2 protein and iNOS and G-CSF mRNA expression in PMA-differentiated human THP-1 monocyte ⁄ macrophages, and this effect is blocked by a PI3K, Akt or mTOR inhibitor (A) THP-1 cells were induced to differentiate by exposure to 160 nM PMA for 24 h and then incubated with or without LPS for h in the absence or presence of LY294002 (50 lM), Akt-in (50 lM) or rapamycin (200 ngỈmL)1); the levels of Oct-2 and b-actin protein were then determined by western blotting (B) Differentiated THP-1 cells were untreated (lane 1), treated with 200 ngỈmL)1 of rapamycin for 30 (lane 3), or treated for h with LPS in the absence (lane 2) or presence (lane 4) of 200 ngỈmL)1 of rapamycin; iNOS, G-CSF and GAPDH mRNA levels were then determined by RT-PCR The results are representative of three independent experiments LY, LY294002; Rapa, rapamycin 100 Discussion 80 * 60 40 20 Control Oct -2 RNAi Fig Knockdown of Oct-2 reduces the LPS-induced increase in iNOS and G-CSF expression in RAW264.7 macrophages RAW264.7 cells were transiently transfected with either pLL 3.7scrambled (Sc) or pLL 3.7-Oct-2 RNA interference (RNAi), then, 24 h later, were untreated or were treated with LPS for h (A) or h (B); the amounts of Oct-2, iNOS and b-actin proteins were then detected by western blotting (A) and the concentration of G-CSF protein in the medium was measured by ELISA (B) The values for the LPS-treated cells were divided by those for the non-LPS-treated cells and are shown as a percentage of the values for the cells transfected with control vector (relative value = 100) The values are expressed as the mean ± sd of three independent experiments *P < 0.01 compared with the LPS-treated control We evaluated the effects of rapamycin on the expression of Oct-2 and its potential target genes, iNOS and G-CSF, in RAW264.7 cells and in THP-1 cells The results demonstrated that rapamycin reduced Oct-2 protein levels and attenuated iNOS and G-CSF expression at the level of transcription in LPS-stimulated macrophages Similar results were obtained by transfection of cells with DN-mTOR, indicating that the LPS-induced increase in Oct-2, iNOS and G-CSF expression occurs through an mTOR-dependent pathway It is very likely that the increase in Oct-2, iNOS, or G-CSF expression occurs through the PI3K ⁄ Akt ⁄ mTOR signaling pathway, as mTOR is downstream of PI3K-Akt, and treatment of cells with LY294002 or an Akt inhibitor, or transfection of cells with DN-Akt, also resulted in a decrease in the LPS-induced increase in Oct-2, iNOS and G-CSF expression (Figs 1B,C,E, and 3B and 7A, and data not shown) Rapamycin has been reported to downregulate NO production by inhibiting phosphorylation [27] or FEBS Journal 278 (2011) 85–96 ª 2010 The Authors Journal compilation ª 2010 FEBS 91 Rapamycin inhibits LPS-induced G-CSF and iNOS expression Y.-Y Chou et al inducing proteasomal degradation [28] of iNOS protein, or by decreasing the secretion of interferon-b [29] However, Attur et al [23] showed that rapamycin inhibits the LPS-induced accumulation of iNOS mRNA in macrophages Our data showed that rapamycin inhibited the accumulation of iNOS mRNA at the transcriptional level and that this effect was caused by a lower amount of Oct-2 These results are in agreement with our previous results showing that downregulation of Oct-2 is responsible for the decrease in LPSinduced iNOS expression in TSA-pretreated macrophages [25] Moreover, we observed that LPS-induced expression of G-CSF was decreased by pretreating macrophages with rapamycin (this study) or TSA (data not shown), which may also be attributed to the decrease in Oct-2 expression caused by these reagents The involvement of Oct-2 in iNOS and G-CSF expression was further supported by the finding that knockdown of Oct-2 expression also attenuated iNOS and G-CSF protein expression (Fig 6) Mutation of the octamer in the iNOS and G-CSF promoters results in a reduction of more than 90% in the LPS-induced promoter activities of these genes [13,30], suggesting the essential role of the octamer and the factors binding to it in LPS-induced gene expression Although involvement of octamer-binding factor-1 (Oct-1), another octamer-binding protein, cannot be excluded in the LPSinduced expression of iNOS and G-CSF, it is very likely that Oct-2 plays a more important role, as the level of expression of iNOS and G-CSF changed in parallel with that of Oct-2, whereas Oct-1 is constitutively expressed and its expression is not changed by treatment with LPS (data not shown) Interestingly, we observed that LPS induced an increase of about 1.6fold in Oct-2 mRNA levels, which was not changed by treatment with rapamycin This result suggests that rapamycin may regulate the production of Oct-2 protein at the post-transcriptional level Treatment with lactacystin, a specific inhibitor of the 26S proteasome, did not change the levels of Oct-2 protein in the presence or absence of LY294002, Akt-in or rapamycin in LPS-treated cells (data not shown) As mTOR regulates cell growth and protein synthesis by increasing the phosphorylation of two major downstream targets – 4E-BP and ribosomal p70 S6 kinase – it is very possible that rapamycin downregulates the Oct-2 protein level by inhibiting Oct-2 protein synthesis Although recombinant G-CSF is routinely used to treat neutropenia and to mobilize hematopoietic stem cells from the bone marrow into the peripheral blood before transplantation [31], it is also expressed endogenously in a variety of cell types in response to treatment with LPS, tumor necrosis factor-a, interleukin-1b, 92 PMA or interferon-c [32] Expression of G-CSF can be regulated at both the transcriptional and posttranscriptional levels [33]; however, the regulatory mechanisms are poorly understood To our knowledge, this is the first study showing that rapamycin reduces the LPS-induced expression of G-CSF at the transcriptional level in macrophages by blocking mTOR activity G-CSF functions as an anti-inflammatory cytokine by activating antibacterial defense by neutrophils and by reducing the release of proinflammatory mediators, thereby preventing the overactivation of monocytes and lymphocytes [34] Thus, a decrease in G-CSF might decrease the host-defense response during infection This could explain, at least in part, the higher mortality rate in LPS-induced shock in rapamycintreated mice compared with control mice [21] In contrast, G-CSF has been demonstrated to induce chronic inflammation and autoimmunity and to exacerbate underlying inflammatory diseases in humans and mice G-CSF deficiency protects mice from collagen-induced arthritis [35], and this effect might be a result of G-CSF not only inducing neutrophil production, but also promoting neutrophil trafficking into inflamed joints [36] Further investigations are required to confirm the clinical usefulness of rapamycin in the treatment of inflammatory diseases In summary, we demonstrated that rapamycin inhibits the LPS-induced increase in iNOS and G-CSF expression through an Oct-2-dependent pathway Our results provide evidence for an interesting role of mTOR in the transcriptional control of LPS-induced gene expression Because of its potent immunosuppressive and antiproliferative properties, there is considerable interest in the use of rapamycin for the treatment of inflammatory diseases As G-CSF can function as either an anti-inflammatory or a proinflammatory cytokine, understanding the mechanism of the effect of rapamycin on G-CSF expression is important Whether rapamycin also inhibits G-CSF expression in other cells, such as rheumatoid synovial fibroblasts, deserves further investigation Materials and Methods Materials LPS from Escherichia coli (serotype 0111:B4) and PMA were purchased from Sigma-Aldrich (St Louis, MO, USA) LY294002, a PI3K inhibitor, 1L6-hydroxymethyl-chiro-inositol-2-(R)-2-O-methyl-3-O-octadecyl-sn-glycerocarbonate, an Akt inhibitor (Akt-in), and rapamycin, an mTOR inhibitor, were purchased from Calbiochem (San Diego, CA, USA) and were dissolved in dimethylsulfoxide Dulbecco’s FEBS Journal 278 (2011) 85–96 ª 2010 The Authors Journal compilation ª 2010 FEBS Y.-Y Chou et al modified Eagle’s medium (DMEM), penicillin ⁄ streptomycin and fetal bovine serum were obtained from GibcoBrl ⁄ LifeTechnologies (Rockville, MD, USA) Rabbit polyclonal anti-Oct-2 and anti-iNOS IgGs, and horseradish peroxidase-conjugated anti-rabbit IgG were purchased from Santa Cruz Biotechnology, Inc (Santa Cruz, CA, USA) Rabbit polyclonal anti-p70 S6 kinase and phospho-p70 S6 kinase (Thr389) IgGs and horseradish peroxidase-conjugated antimouse IgG were purchased from Cell Signaling Technology (Beverly, MA, USA) Mouse monoclonal anti-b-actin IgG was purchased from Chemicon (Temecula, CA, USA) Restriction endonucleases were obtained from New England Biolabs (Beverly, MA, USA) The pGL3-Basic and phRLTK reporter plasmids, the Dual-LuciferaseÒ Reporter Assay System and the Griess reagent system were from Promega (Madison, WI, USA) The SuperFect Transfection Reagent was purchased from Qiagen (Hilden, Germany), the mouse G-CSF Quantikine ELISA kit from R&D Systems (Minneapolis, MN, USA), the ChIP assay kit from Upstate Biotechnology (Lake Placid, NY, USA) and protein A–Sepharose beads from Amersham Biosciences (Chandler, AZ, USA) Plasmids pCG-Oct-1 and pCG-Oct2, and their parent plasmid, pCG, were gifts from Dr W Herr (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, USA) [37] The expression plasmid for DN-Akt (hemagglutinin-tagged Akt K179M) was kindly provided by Dr Mien-Chie Hung (University of Texas M D Anderson Cancer Center) [38], and those for DN-mTOR (hemagglutinin-tagged mTOR N2343K) and RR-mTOR (hemagglutinin-tagged mTOR S2035T) were kindly provided by Dr Kazuyoshi Yonezawa (Biosignal Research Center, Kobe University) [39] Rapamycin inhibits LPS-induced G-CSF and iNOS expression Cell culture and LPS treatment RAW264.7, a murine macrophage cell line, was cultured in DMEM supplemented with 10% fetal bovine serum, mm glutamine, 100 mL)1 of penicillin and 100 lgỈmL)1 of streptomycin at 37 °C in 5% CO2, as described previously [24,25] The human acute monocytic leukemia cell line THP1 was obtained from the American Type Culture Collection, and was maintained and induced to differentiate using 160 nm PMA, as described previously [40] In these experiments, Oct-2, iNOS and G-CSF mRNA and protein levels, NO production, the phosphorylation levels of p70 S6 kinase and the transactivation and activity of the G-CSF promoter were compared between untreated cells and cells treated with 100 ngỈmL)1 of LPS (RAW264.7 and THP-1 cells) When inhibitors were used, they were added 30 before the LPS Plasmid construction A DNA fragment containing nucleotides )283 to +35 of the mouse G-CSF promoter was PCR-amplified from genomic DNA using the primers listed in Table 1; the underlined sequences are MluI and BglII sites created to facilitate cloning The DNA fragment was cloned into the MluI ⁄ BglII sites of the pGL3-basic luciferase reporter vector to obtain the pG-CSF()283 ⁄ +35)-Luc reporter plasmid The transcription start site (+1) was assigned according to Nagata et al [12,41] The Oct-2 short hairpin RNA plasmid (pLL 3.7-Oct-2) was constructed as described previously [24] All constructs were verified by restriction mapping and sequencing Table Primers used in this study Sequence (5¢ fi 3¢) Oligonucleotides used for plasmid construction G-CSF promoter Oligonucleotides used for RT-PCR Oct-2 a iNOS a Mouse G-CSF Human G-CSF GAPDH a Oligonucleotides used for the ChIP assay G-CSF promoter iNOS promoter a Forward ACGCGTAGATCCAACACCCTGCAGCGAT Reverse AGATCTGATTCTGGGTGATCTGGGCTGCA Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse AATGGACCCGACATTAACCA AAATGGTCGTTTGGCTGAAG AGGAACATCTGGCCAGGCTG ACTTGGGATGCTCCATGGTC CTCAACTTTCTGCCCAGAGG CTGGAAGGCAGAAGTGAAGG CACTCTGGACAGTGCAGGAAG CGACACCTCCAGGAAGCTCTG AAAGGATCCACTGGCGTCTTCACCACC GAATTCGTCATGGATGACCTTGGCCAG Forward Reverse Forward Reverse TGGCTGGAAGAGAGGAAGAG CTGGGGCAACTCAGGCTTA AACTGGGGACTCTCCCTTTG CTACTCCGTGAAGTGAACAA Primers that can be used to amplify both human and mouse Oct-2, iNOS and GAPDH cDNA FEBS Journal 278 (2011) 85–96 ª 2010 The Authors Journal compilation ª 2010 FEBS 93 Rapamycin inhibits LPS-induced G-CSF and iNOS expression Y.-Y Chou et al Transient transfection Reporter gene activity assay Transient transfection was carried out using the SuperFect Transfection Reagent, as described previously [24] Briefly, RAW264.7 cells were plated and cultured overnight before transfection Twenty-four hours after transfection, the cells were either untreated or were pretreated with vehicle or specific inhibitors for 30 before incubation with 100 ngỈmL)1 of LPS To measure G-CSF promoter activity, 0.9 lg of the G-CSF promoter-luciferase reporter plasmid pG-CSF ()283 ⁄ +35)Luc was mixed with 0.1 lg of phRLTK plasmid and the mixture was used to transiently transfect RAW264.7 cells, as described above Photinus and Renilla luciferase activities in the cell lysates were assayed using the Dual-Luciferase Reporter Assay System, as described previously [24], and the light intensity produced by Photinus luciferase (test plasmid) was normalized to that produced by Renilla luciferase (control plasmid) RNA isolation and RT-PCR Following treatment, total RNA in RAW264.7 and THP-1 cells was isolated by acid guanidinium thiocyanate ⁄ phenol ⁄ chloroform extraction, according to the method of Chomczynski and Sacchi [42] The concentration and purity of the RNA were measured by reading the absorbances at 260 nm and 280 nm, respectively, on a spectrophotometer The levels of Oct-2, G-CSF, iNOS or glyceraldehyde-3phosphate dehydrogenase (GAPDH) mRNAs were determined by semiquantitative RT-PCR using the primers listed in Table The amplified DNA fragments were separated by electrophoresis through a 1% agarose gel and sequenced to confirm their identity Western blot analysis Samples of cell lysates (40 lg of protein per lane) from RAW264.7 and THP-1 cells were separated by SDS ⁄ PAGE on 8% gels and transferred onto a poly(vinylidene difluoride) membrane, which was then blocked for h at room temperature with blocking buffer [TBST (150 mm NaCl, 10 mm Tris ⁄ HCl and 0.05% Tween 20, pH 7.4) containing 5% (w ⁄ v) nonfat dried milk] The blots were then incubated overnight at °C with primary antibodies in blocking buffer, washed with TBST, and incubated for 40 at room temperature with horseradish peroxidase-conjugated secondary antibodies in blocking buffer Immunoreactive bands were detected using Western LightningÒ Western Blot Chemiluminescence Reagent Plus (Perkin-Elmer, Boston, MA, USA), following the manufacturer’s instructions, and by autoradiography using Kodak BioMax MR films (Eastman Kodak, Rochester, NY, USA) Quantification of G-CSF and nitrite in culture medium The concentration of G-CSF in the culture medium of RAW264.7 cells was measured by an ELISA using a mouse G-CSF Quantikine ELISA kit (R&D Systems) according to the manufacturer’s instructions The levels of NO in the culture medium of RAW264.7 cells were measured using a Griess reagent system kit, according to the manufacturer’s instructions [25] The limit of detection for G-CSF and nitrite was pgỈmL)1 and 2.5 lm, respectively 94 ChIP assay The ChIP assay was performed as described previously [24] Briefly, after various treatments, the cells were fixed with 1% (w ⁄ w) formaldehyde for 10 at 37 °C to crosslink proteins to DNA, collected by scraping and then sonicated on ice by pulsing eight times for 10 s at a power setting of 30% using a Microson Ultrasonic Cell Disrupter KL A portion of the sample was kept as input material and the rest of the fragmented chromatin was immunoprecipitated with anti-Oct-2 IgG or control rabbit IgG, then the crosslinks were reversed by incubation at 65 °C for h, the proteins were digested with proteinase K for h at 45 °C and the DNA was recovered by phenol ⁄ chloroform extraction and ethanol precipitation and used as the template for PCR with the primers listed in Table The input material was similarly subjected to de-crosslinking, DNA recovery and PCR analysis Thirty PCR cycles were used for all ChIP experiments and 28 PCR cycles were used for the input samples Statistical analysis The results are shown as the mean ± SD Differences between means were evaluated using the Student’s t-test and were considered significant at P < 0.01 Acknowledgements This study was supported by the National Science Council of Taiwan grant NSC97-2320-B-002-057-MY3 and NSC99-2320-B-038-009-MY3 References Raetz CR (1990) Biochemistry of endotoxins Annu Rev Biochem 59, 129–170 Beutler B & Rietschel ET (2003) Innate immune sensing and its roots: the story of endotoxin Nat Rev Immunol 3, 169–176 Sweet MJ & Hume DA (1996) Endotoxin signal transduction in macrophages J Leukoc Biol 60, 8–26 FEBS Journal 278 (2011) 85–96 ª 2010 The Authors Journal compilation ª 2010 FEBS Y.-Y Chou et al Guha M & Mackman N (2001) LPS induction of gene expression in human monocytes Cell Signal 13, 85–94 Fujihara M, Muroi M, Tanamoto K, Suzuki T, Azuma H & Ikeda H (2003) Molecular mechanisms of macrophage activation and deactivation by lipopolysaccharide: roles of the receptor complex Pharmacol Ther 100, 171–194 MacMicking J, Xie QW & Nathan C (1997) Nitric oxide and macrophage function Annu Rev Immunol 15, 323–350 Lieschke GJ, Grail D, Hodgson G, Metcalf D, Stanley E, Cheers C, Fowler KJ, Basu S, Zhan YF & Dunn AR (1994) Mice lacking granulocyte colony-stimulating factor have chronic neutropenia, granulocyte and macrophage progenitor cell deficiency, and impaired neutrophil mobilization Blood 84, 1737–1746 Noursadeghi M, Bickerstaff MC, Herbert J, Moyes D, Cohen J & Pepys MB (2002) Production of granulocyte colony-stimulating factor in the nonspecific acute phase response enhances host resistance to bacterial infection J Immunol 169, 913–919 Kleinert H, Schwarz PM & Forstermann U (2003) Regulation of the expression of inducible nitric oxide synthase Biol Chem 384, 1343–1364 10 Kleinert H, Pautz A, Linker K & Schwarz PM (2004) Regulation of the expression of inducible nitric oxide synthase Eur J Pharmacol 500, 255–266 11 Hareng L & Hartung T (2002) Induction and regulation of endogenous granulocyte colony-stimulating factor formation Biol Chem 383, 1501–1517 12 Nishizawa M, Tsuchiya M, Watanabe-Fukunaga R & Nagata S (1990) Multiple elements in the promoter of granulocyte colony-stimulating factor gene regulate its constitutive expression in human carcinoma cells J Biol Chem 265, 5897–5902 13 Nishizawa M & Nagata S (1990) Regulatory elements responsible for inducible expression of the granulocyte colony-stimulating factor gene in macrophages Mol Cell Biol 10, 2002–2011 14 Morrison DC & Ryan JL (1987) Endotoxins and disease mechanisms Annu Rev Med 38, 417–432 15 Cohen J (2002) The immunopathogenesis of sepsis Nature 420, 885–891 16 Vanhaesebroeck B & Waterfield MD (1999) Signaling by distinct classes of phosphoinositide 3-kinases Exp Cell Res 253, 239–254 17 Fruman DA, Meyers RE & Cantley LC (1998) Phosphoinositide kinases Annu Rev Biochem 67, 481–507 18 Datta SR, Brunet A & Greenberg ME (1999) Cellular survival: a play in three Akts Genes Dev 13, 2905–2927 19 Hay N & Sonenberg N (2004) Upstream and downstream of mTOR Genes Dev 18, 1926–1945 20 Weichhart T & Saemann MD (2008) The PI3K ⁄ Akt ⁄ mTOR pathway in innate immune cells: emerging thera- Rapamycin inhibits LPS-induced G-CSF and iNOS expression 21 22 23 24 25 26 27 28 29 30 31 FEBS Journal 278 (2011) 85–96 ª 2010 The Authors Journal compilation ª 2010 FEBS peutic applications Ann Rheum Dis 67(Suppl 3), iii70– 74 Schmitz F, Heit A, Dreher S, Eisenacher K, Mages J, Haas T, Krug A, Janssen KP, Kirschning CJ & Wagner H (2008) Mammalian target of rapamycin (mTOR) orchestrates the defense program of innate immune cells Eur J Immunol 38, 2981–2992 Loewith R, Jacinto E, Wullschleger S, Lorberg A, Crespo JL, Bonenfant D, Oppliger W, Jenoe P & Hall MN (2002) Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control Mol Cell 10, 457–468 Attur MG, Patel R, Thakker G, Vyas P, Levartovsky D, Patel P, Naqvi S, Raza R, Patel K, Abramson D et al (2000) Differential anti-inflammatory effects of immunosuppressive drugs: cyclosporin, rapamycin and FK-506 on inducible nitric oxide synthase, nitric oxide, cyclooxygenase-2 and PGE2 production Inflamm Res 49, 20–26 Lu SC, Chang SF, Chen HL, Chou YY, Lan YH, Chuang CY, Yu WH & Chen CL (2007) A novel role for Oct-2 in the lipopolysaccharide-mediated induction of resistin gene expression in RAW264.7 cells Biochem J 402, 387–395 Lu SC, Wu HW, Lin YJ & Chang SF (2009) The essential role of Oct-2 in LPS-induced expression of iNOS in RAW 264.7 macrophages and its regulation by trichostatin A Am J Physiol Cell Physiol 296, C1133–1139 Brunn GJ, Williams J, Sabers C, Wiederrecht G, Lawrence JC Jr & Abraham RT (1996) Direct inhibition of the signaling functions of the mammalian target of rapamycin by the phosphoinositide 3-kinase inhibitors, wortmannin and LY294002 EMBO J 15, 5256–5267 Salh B, Wagey R, Marotta A, Tao JS & Pelech S (1998) Activation of phosphatidylinositol 3-kinase, protein kinase B, and p70 S6 kinases in lipopolysaccharide-stimulated Raw 264.7 cells: differential effects of rapamycin, Ly294002, and wortmannin on nitric oxide production J Immunol 161, 6947–6954 Jin HK, Ahn SH, Yoon JW, Park JW, Lee EK, Yoo JS, Lee JC, Choi WS & Han JW (2009) Rapamycin down-regulates inducible nitric oxide synthase by inducing proteasomal degradation Biol Pharm Bull 32, 988–992 Weinstein SL, Finn AJ, Dave SH, Meng F, Lowell CA, Sanghera JS & DeFranco AL (2000) Phosphatidylinositol 3-kinase and mTOR mediate lipopolysaccharidestimulated nitric oxide production in macrophages via interferon-beta J Leukoc Biol 67, 405–414 Xie Q (1997) A novel lipopolysaccharide-response element contributes to induction of nitric oxide synthase J Biol Chem 272, 14867–14872 Welte K, Gabrilove J, Bronchud MH, Platzer E & Morstyn G (1996) Filgrastim (r-metHuG-CSF): the first 10 years Blood 88, 1907–1929 95 Rapamycin inhibits LPS-induced G-CSF and iNOS expression Y.-Y Chou et al 32 Demetri GD & Griffin JD (1991) Granulocyte colonystimulating factor and its receptor Blood 78, 2791– 2808 33 Falkenburg JH, Harrington MA, de Paus RA, Walsh WK, Daub R, Landegent JE & Broxmeyer HE (1991) Differential transcriptional and posttranscriptional regulation of gene expression of the colonystimulating factors by interleukin-1 and fetal bovine serum in murine fibroblasts Blood 78, 658–665 34 Boneberg EM & Hartung T (2002) Molecular aspects of anti-inflammatory action of G-CSF Inflamm Res 51, 119–128 35 Lawlor KE, Campbell IK, Metcalf D, O’Donnell K, van Nieuwenhuijze A, Roberts AW & Wicks IP (2004) Critical role for granulocyte colony-stimulating factor in inflammatory arthritis Proc Natl Acad Sci USA 101, 11398–11403 36 Eyles JL, Hickey MJ, Norman MU, Croker BA, Roberts AW, Drake SF, James WG, Metcalf D, Campbell IK & Wicks IP (2008) A key role for G-CSFinduced neutrophil production and trafficking during inflammatory arthritis Blood 112, 5193–5201 96 37 Tanaka M and Herr W (1990) Differential transcriptional activation by Oct-1 and Oct-2: interdependent activation domains induce Oct-2 phosphorylation Cell 60, 375–386 38 Zhou BP, Liao Y, Xia W, Zou Y, Spohn B & Hung MC (2001) HER-2 ⁄ neu induces p53 ubiquitination via Akt-mediated MDM2 phosphorylation Nat Cell Biol 3, 973–982 39 Hara K, Yonezawa K, Kozlowski MT, Sugimoto T, Andrabi K, Weng QP, Kasuga M, Nishimoto I & Avruch J (1997) Regulation of eIF-4E BP1 phosphorylation by mTOR J Biol Chem 272, 26457–26463 40 Chou SF, Chen HL & Lu SC (2002) Up-regulation of human deoxyribonuclease II gene expression during myelomonocytic differentiation of HL-60 and THP-1 cells Biochem Biophys Res Commun 296, 48–53 41 Tsuchiya M, Kaziro Y & Nagata S (1987) The chromosomal gene structure for murine granulocyte colonystimulating factor Eur J Biochem 165, 7–12 42 Chomczynski P & Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction Anal Biochem 162, 156–159 FEBS Journal 278 (2011) 85–96 ª 2010 The Authors Journal compilation ª 2010 FEBS ... octamer and the factors binding to it in LPS-induced gene expression Although involvement of octamer-binding factor- 1 (Oct-1), another octamer-binding protein, cannot be excluded in the LPSinduced expression. .. expression of iNOS and G-CSF protein and mRNA were evaluated in macrophages, and the involvement of Oct-2 in LPS ⁄ mTOR-induced iNOS and G-CSF expression was investigated further Results Rapamycin inhibits. .. and be inhibited by the mTOR inhibitor, rapamycin In addition, Oct-2 is involved in the expression of LPS -inducible genes that contain octamer in their promoters [24,25] Thus, rapamycin may inhibit