Báo cáo y học: " Oral vaccination with a recombinant Salmonella vaccine vector provokes systemic HIV-1 subtype C Gag-specific " ppt
Báo cáo y học: " Oral vaccination with a recombinant Salmonella vaccine vector provokes systemic HIV-1 subtype C Gag-specific " ppt
... that vaccination of mice orally with the Salmonella vaccine vector induced systemic Gag-spe-cific Th1 and Th2 cytokine responses. Oral vaccination of mice with recombinant Salmonella induces Gag-specific ... Elecsys® HIV p24 Ag assay (Roche) according tomanufacturer's recommendations. Salmonella vaccine stocksStocks of recombinant Salmonella bacterial vaccines wereprepared from culture colonies ... BioMed CentralPage 1 of 9(page number not for citation purposes)Virology JournalOpen AccessResearch Oral vaccination with a recombinant Salmonella vaccine vector provokes systemic HIV-1 subtype...
- 9
- 217
- 1
Báo cáo y học: " Initial experience with a synthetic sealant PleuraSeal™ after pulmonary resections: a prospective study with retrospective case matched controls" docx
... Brunelli A, Xiume F, Al RM, Salati M, Marasco R, Sabbatini A: Air leaks after lobectomy increase the risk of empyema but not of cardiopulmonary complications: a case-matched analysis. Chest 2006, ... difficult to access by standardsuturing or fleece-bond sealants, PleuraSeal™ as a liquidsealant is ideal to seal air leaks in this interlobar space with its many anatomical variations. As part ... Thorac Cardiovasc Surg 1999, 117:751-758.21. Locicero J: Evaluation of PleuraSeal™ Sealant System as a Thoracic Sealant in a Canine Lung Resection Model. In North American Science Associates...
- 9
- 214
- 0
Báo cáo y học: " Oral involvement in a case of AA amyloidosis: a case report" pps
... caused by the amyloidosis.IntroductionReactive systemic AA amyloidosis, with a sustained acutephase response (APR), can complicate chronic inflamma-tory disorders. AA amyloid fibrils are derived ... approximately45% of all cases of systemic amyloidosis, has been associ-ated with various chronic inflammatory conditions such* Correspondence: dtinanc@mynet.com1 Zonguldak Karaelmas University, ... formation and disappearance of amyloid in man. Acta Chir Scand 1928, 63:479-530.17. Gertz MA, Lacy MQ, Dispenzieri A: Amyloidosis, recognition, confirmation, prognosis, and therapy. Mayo Clin...
- 6
- 346
- 0
Báo cáo y học: "Stable expression of a recombinant human antinucleosome antibody to investigate relationships between antibody sequence, binding properties, and pathogenicity" doc
... and pathogenicityLesley J Mason1, Anastasia Lambrianides2, Joanna D Haley2, Jessica J Manson1, David S Latchman2, David A Isenberg1 and Anisur Rahman11Centre for Rheumatology, ... possibility.Introduction Systemic lupus erythematosus (SLE) is an autoimmune rheu-matic disease of unknown aetiology, characterised by thepresence of autoantibodies against a multiplicity of nuclear,cytoplasmic, and ... line,transfected with empty expression vector (i.e. containing noheavy chain or light chain variable region cDNA), produced nodetectable IgG.Open AccessAvailable online http://arthritis-research.com/content/7/5/R971R971Vol...
- 13
- 472
- 0
Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot
... signifi-cantly enhanced stimulatory capacity in mixed leukocyteculture and the ability to promote CD8 T cell expansionand cytolytic capacity.Therefore, this approach yields malignant cell loaded ... apoptotic cells found in co-cultures of a: CD8 T cells and DC loaded with apoptotic malignant T cells; b: CD8 T cells, DC and viable CTCL cells; c: DC loaded with apoptotic CTCL in the absence of CD8 ... positive cell. A representative activated monocyte/DC is shown after CD4 column passage and recombination with viable CTCL cells as detected by d: membrane class II-FITC (green); e: cytopolasmic APO2-PE...
- 16
- 251
- 0
Báo cáo y học: "Clinical aspects of a nationwide epidemic of severe haemolytic uremic syndrome (HUS) in children" ppt
... The clinical course was characterized by anaggressive disease with significant extrarenal complica-tions. In Norway there are five University Hospitals with paediatric departments, all in close ... diarrhea-associated hemolytic uremic syndrome: a systematic review and meta-analysis. Diabetes Care 2005, 28:2556-2562.21. Gallo EG, Gianantonio CA: Extrarenal involvement in diarrhoea-associatedhaemolytic-uraemic ... was characterized by a veryhigh incidence of HUS, and the majority of the affectedchildren experienced severe renal disease and significantextrarenal complications. Although genetic variabilitytheoretically...
- 6
- 288
- 0
Báo cáo y học: "Comparative biochemical analysis of recombinant reverse transcriptase enzymes of HIV-1 subtype B and subtype " ppt
... 5’-TTAAAAGAAAAGGGGGG-3’;pp57D, 5’-CGTTGGGAGTGAATTAGCCCTTCCA-GTCCCCCCTTTTCTTTTAAAAAGTGGCTAAGA-3’;kim40R, 5’-AAGCTTGGCTGCAGAATATTGCTAG-CGGGAATTCGGCGCG-3’;kim32D, 5’-CGCGCCGAATTCCCGCTAGCAATAT-TCTGCAG-3’;Tenofovir ... 3’-GACGTCTTATAACGATCGCCCTTAAGCCGCGC-5’-1 -10 -20Kim40R 5’-AAGCUUGGCUGCAGAAUAUUGCUAGCGGGAAUUCGGCGCG-3’Kim32D 3’-GACGTCTTATAACGATCGCCCTTAAGCCGCGC-5’RNase H activity w/o trap RNase H activity w/ trapBKim32D 3GACGTCTTATAACGATCGCCCTTAAGCCGCGC5Kim32D ... either subtype for enzyme analysis, drug design, and for study-ing mechanisms of drug resistance. A Kim40R 5’-AAGCUUGGCUGCAGAAUAUUGCUAGCGGGAAUUCGGCGCG-3’Kim32D 3’-GACGTCTTATAACGATCGCCCTTAAGCCGCGC-5’-1...
- 11
- 241
- 0
Báo cáo y học: " Effects of the K65R and K65R/M184V reverse transcriptase mutations in subtype C HIV on enzyme function and drug resistance" pps
... gel-based assays with HIV-1 PBS RNAtemplate and tRNA3Lys as primer. Single-cycle processivity was assayed under variable dNTPconcentrations. Steady-state analysis was performed to measure ... activities are expressed as a percentage of subtype B wild-type RT specific activity. (C) Incorporation efficiency of TFV-DP by subtype C WT and mutant RTs was monitored by gel-based assay and a representative ... linear regressionanalyses using GraphPad Prism 4.0 software. Specificactivities were calculated as described previously [18]. Allvalues are presented as a percentage of specific activity ofsubtype...
- 11
- 255
- 0
Báo cáo y học: "Co-existence of a giant splenic hemangioma and multiple hepatic hemangiomas and the potential association with the use of oral contraceptives: a case report" potx
... hematoma.Angiographic appearance of cavernous splenic hemangiomaFigure 2Angiographic appearance of cavernous splenic hemangioma. 1. Splenic artery (black arrows). 2. Celiac trunk (white arrow).Journal ... with multiple hepatic hemangiomas. Pathogenetic mechanisms between hemangiomas and oral contraceptives, as well as therapeutic approaches, are analyzed in this case report, in particular forthe management ... purposes)Journal of Medical Case ReportsOpen AccessCase reportCo-existence of a giant splenic hemangioma and multiple hepatic hemangiomas and the potential association with the use of oral contraceptives:...
- 5
- 384
- 0
Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx
... EGFP–N2-hspry4, composed of vector EGFP-N2(Clontech, Palo Alto, CA, USA) and hspry4 cDNA, wasconstructed with primers: 5¢-TTAGGATCCATGCTCAGCCCCCTCCCC-3¢ forward and 5¢-GGAATTCTCCGAAAGGCTTGTCGG-3¢reverse, ... proteinconcentrations as determined by BCA assay (Bio-Rad).Yeast two-hybrid assayFull-length human sprouty 4 cDNA was amplified by PCR with forward primer 5¢-CTAGTCGACATGCTCAGCCCCCTCCCC-3¢ and reverse ... hspry4 could similarly act as aninhibitor of ras, a pcDNA3.1(+) eukaryotic expression vector, containing HA-tagged hspry4 was constructed.Kinase activity of cotransfected Myc-tagged MAP kinasewas...
- 11
- 542
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM