0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Subacute herpes simplex virus type 1 encephalitis as an initial presentation of chronic lymphocytic leukemia and multiple sclerosis: a case report" doc

Báo cáo y học:

Báo cáo y học: "Subacute herpes simplex virus type 1 encephalitis as an initial presentation of chronic lymphocytic leukemia and multiple sclerosis: a case report" doc

... this article as: Singhal and Corman: Subacute herpes simplex virus type 1 encephalitis as an initial presentation of chronic lymphocytic leukemia and multiple sclerosis: a case report. Journal of ... IgM Ab titer < ;1: 16 and < ;1: 20(< ;1: 16 and < ;1: 20)LCMV IgG and IgM Abtiter< ;1: 1 and < ;1: 1 (< ;1: 1 and < ;1: 1)WNV IgG and IgM Ab Negative WNV IgG and IgM Ab NegativeToxoplasma ... lymphocytic leukemia. This unusual case of herpes simplex virus type 1 encephalitis emphasizes the importance of T cellfunction in diseases of immune dysregulation and autoimmunity such as chronic...
  • 7
  • 403
  • 0
Báo cáo y học:

Báo cáo y học: " Human T-lymphotropic virus type-1 p30 alters cell cycle G2 regulation of T lymphocytes to enhance cell survival" pptx

... mediated pri-marily by Chk1 and other kinases including Chk2 orCdc25C associated kinase (cTAK1). Chk1 is activated byphosphorylation mediated by ataxia telangiectasiamutated and rad 3 related ... (Invitrogen)was used F5-ACCCCCACTGAAAAAGATAC-3 and R5-ATCTTCAAACCTCCATGATG-3. Cycles were varied from 15 cycles to 30 cycles in order to compare transcript levelsbetween p30 Jurkat T-cells and ACH.2 ... Beverly, MA), rabbit polyclonal anti-PLK1pT 210 # 600-4 01- 466 (1: 10 00, Rockland, Gilberts-ville, PA), polyclonal rabbit anti-Cdc2 T -16 1 # 911 4 (1: 1000, Cell Signaling), polyclonal rabbit anti...
  • 15
  • 170
  • 0
Báo cáo y học:

Báo cáo y học: " Human T Lymphotropic Virus Type 1 protein Tax reduces histone levels" pot

... CCTGTAAAGAAGAAGGCGGCCAAA;H1S -1 Rev CAGAGAAACTCCGCTACGCTCTTT;H1S-2 Fwd CCCAGTATCTGAGCTTATCACCAAGG;H1S-2 Rev TTTCTTAAGCGCGGCCAGAGAAAC;H1S-3 Fwd CCCGGCTAAGAAGAAGGCAACTAA;H1S-3 Rev GAAAGGCCATTGCGCTCCTTAGAA;H1S-4 ... TGCGCCCAAGAAGGGTTCTAAA;H2B Rev ACGAAGGAGTTCATGATGCCCA;H3 Fwd TGCTCATCCGCAAACTGCCATT; H3 Rev AGT-GACACGCTTGGCGTGAATA; H4 Fwd ACCGTAAAGTACTGCGCGACAA; H4 Rev TTCTCCAGGAACACCTTCAGC A; H1S -1 Fwd ... AC, Schor D, Araujo A, Andrada-Serpa MJ:Human T lymphotropic virus type 1 (HTLV -1) proviral loadin asymptomatic carriers, HTLV -1- associated myelopathy/tropical spastic paraparesis, and other...
  • 14
  • 268
  • 0
Báo cáo y học:

Báo cáo y học: " Human T lymphotropic virus type-1 p30II alters cellular gene expression to selectively enhance signaling pathways that activate T lymphocytes" doc

... suppressingsubtransferable candidate 3 and TNF receptor superfamilymember 25. p30II expression was also associated withdecreased expression of caspases (2 and 4) and increasedexpression of genes associated ... type 1. AIDS ResHum Retroviruses 2000, 16 :16 03 -16 06.48. Mori N, Ueda A, Ikeda S, Yamasaki Y, Yamada Y, Tomonaga M, Mori-kawa S, Geleziunas R, Yoshimura T, Yamamoto N: Human T-cell leukemia ... was associated with decrease in cyclin B1 and WEE1kinase levels, suggesting that p30II expression likely causeG2 arrest and may thus modulate transcriptional activity of NFAT, NF-κB and AP -1, ...
  • 12
  • 487
  • 0
Báo cáo y học:

Báo cáo y học: " Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

... tuberculouspericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report. Journal of Medical Case Reports2 010 4:246.Lin et al. Journal of Medical Case Reports ... lymphocytic leukemia can mimic tuberculosis. Case Presentation: We report the case of a 58-year-old African American-Nigerian woman with a history of travelto Nigeria and a positive tuberculin ... cardiac tamponade. She had a mild fever,lymphocytosis and a bloody pericardial effusion, but cultures and stains were negative for acid-fast bacteria.Assessment of blood by flow cytometry and...
  • 4
  • 398
  • 0
Báo cáo y học:

Báo cáo y học: "Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

... tamponade as an initial manifestation of malignancy is relatively uncommon. A review of 78 cases revealed that 60% of such cases stemmedfrom lung carcinomas whereas only 9% originatedfrom leukemia ... McManus BM: Pericarditis and earlycardiac tamponade as a primary manifestation of lymphosarcoma cell leukemia. Am J Med 19 79, 67: 719 -723. 13 . Leung WH, Tai YT, Lau CP, Wong CK, Cheng CH, Chan ... levels and remained asympto-matic). Management of pericardial effusions as initial presentations of malignancy is not well established,though some reports have suggested systemic che-motherapy and...
  • 4
  • 399
  • 0
Báo cáo y học:

Báo cáo y học: "Post-transplant lymphoproliferative disorder involving the ovary as an initial manifestation: a case report" potx

... series of 19 lymphomas and 1 granulocytic sarcoma. Cancer 19 74, 34:397-407.4. Fox H, Langley FA, Govan AD, Hill AS, Bennett MH: Malignant lymphoma presenting as an ovarian tumour: a clinicopathological ... of a disseminated disease, itis unusual to find an ovarian mass as an initial manifesta-tion [2]. Patients with ovarian malignant lymphoma have a poor prognosis [2]. We report an unusual case ... initial manifestation. Case presentation: Twenty-nine weeks after a living renal transplantation, a 38-year-old Japanese female, whose ethnic origin was Asian, presented with abdominal pain and a...
  • 3
  • 270
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " The herpes simplex virus UL20 protein functions in glycoprotein K (gK) intracellular transport and virus-induced cell fusion are independent of UL20 functions in cytoplasmic virion envelopment" docx

... 2.Intracellular transport and TGN localization of UL20p mutants and gKTransport and localization of UL20p and gK was furtherassessed by transient coexpression of gK and UL20p and simultaneous ... AGTIY49AYSRASRI CL38-CL49 YGT-YSR AGA-AAAI Y3 8A -Y4 9A YGT-YSR AGT-ASRICL61SKRSKAIV CL153 ETFSPD AAFAPAV, C-Truncation 204t SANFF SANGV, C-Truncation 211 t RFWTR RFWG*V, C-Truncation 216 t AILNA AILG**Indicates ... interdependentstrongly suggesting that gK and UL20p physically inter-acted [ 31] . Similar confocal colocalization assays wereperformed to test the ability of each UL20 mutant to facil-itate transport and colocalization...
  • 12
  • 526
  • 0
Báo cáo y học:

Báo cáo y học: "Gitelman’s syndrome with persistent hypokalemia - don’t forget licorice, alcohol, lemon juice, iced tea and salt depletion: a case report" ppsx

... tea and low salt intake can further aggravate hypo -kalemia and provoke clinical symptoms. Case presentation A 31- year-old, previously healthy Caucasian Swiss manwas admitted to our hospital ... which may aggravate the disease. Case presentation: We describe the case of a 31- year-old, previously ap parently healthy Caucasian Swiss manwho presented to our hospital with gait disturbance of ... clinical symptoms. Finally, vomiting and failure to replace salt led to volume depletion and hypokalemiccrisis, with a plasma potassium level of 1. 0 mmol/L and paralysis with respiratory failure...
  • 5
  • 396
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ