0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt

 Báo cáo y học:

Báo cáo y học: "Clinical review: Treatment of new-onset atrial fibrillation in medical intensive care patients – a clinical framework"

... improvesurvival?There are few data on the effect of treatment of AF on mortality in ICU patients. A meta-analysis in non-ICU patients showedthat class IA, class IC and class III antiarrhythmic agents areequally ... placebo[91,94-97]. A meta-analysis showed that class IA, class ICand class III antiarrhythmic agents are equally effective in obtaining SR [98]. Meta-analyses comparing amiodaronewith class IC antiarrythmic ... Connolly SJ: Evidence-based analysis of amiodarone efficacyand safety. Circulation 1999, 100:2025-2034.115. Hughes M, Binning A: Intravenous amiodarone in intensive care. Time for a reappraisal? Intensive...
  • 10
  • 818
  • 0
Báo cáo y học:

Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf

... amplified by two primer pairs (CCR5-F1:5'ATGGAGGGCAACTAAATACATT3'; CCR5-R1:5'AGATGACTATCTTTAATGTCTG3'; CCR5-F2:5'CTCTCATTTTCCATACAGTCAGTATCA3'; CCR5-R2:5'AAGCCATGTGCACAACTCTGACTG3') ... distribution of the genetic variants CCR5-Delta 32 and CD45-C77G in a cohort of Italian het-erosexually HIV-1 exposed and uninfected individuals.Our data suggest a partial protective effect of CCR5-Delta 32 ... signifi-cantly associated with lower rates of HIV-1 infectionamong white individuals. Marmor et al [16], analyzing a large sample of individuals, found a protective role of CCR5-Delta 32 allele in uninfected...
  • 4
  • 384
  • 0
Báo cáo y học:

Báo cáo y học: "Failed surgical ligation of the proximal left subclavian artery during hybrid thoracic endovascular aortic repair successfully managed by percutaneous plug or coil occlusion: a report of 3 cases" ppsx

... this article as: Maleux et al.: Failed surgical ligation of the proximal left subclavian artery during hybrid thoracic endovascular aortic repair successfully managed by percutaneous plug or coil ... exclude the thoracic aneurysm with use of a stent-graft (Valiant,Medtronic, Santa Clara, CA, USA) after placing a caroti-dosubclavian bypass and ligation of the proximal left subclavian artery in order ... to the left subclavian artery wasperformed using a Silver 8 mm vascular graft; concomi-tantly a surgical ligation of the left subclavian artery proximal to the origin of the left vertebral artery...
  • 6
  • 409
  • 0
Báo cáo y học:

Báo cáo y học: "Successful surgical excision of primary right atrial angiosarcoma" docx

... photographs of primary right atrial angiosarcoma . A. Intraoperative photograph; initial view of the right atrial tumor during surgery. B. Macroscopic photograph; broadly resected large tumor of the right ... Contrastangiogram of the right coronary artery (right anterior oblique projection) showing the right coronary artery and two right atrial branches (redarrowheads) with several small areas of abnormal ... Successful surgical excision of primary right atrial angiosarcoma. Journal of Cardiothoracic Surgery 2011 6:47.Submit your next manuscript to BioMed Centraland take full advantage of: ã Convenient...
  • 6
  • 337
  • 0
Báo cáo y học:

Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt

... CAS E REP O R T Open AccessSuccessful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case ... reportDaisuke Yoshioka, Toshiki Takahashi*, Toru Ishizaka and Takuya HiguchiAbstractCardiac myxoma is the most common primary cardiac tumour, but infected cardiac myxoma is relatively rare. Infected ... surgical treatment of a case of infected left atrial myxoma with septic shock, DIC and cerebral infarction without he morrahage. Collective review of 58 reported cases with infected cardiacmyxoma...
  • 4
  • 543
  • 0
Báo cáo y học:

Báo cáo y học: "Right coronary artery originating from left anterior descending artery: a case report" pptx

... RCA as a branch of LAD is very rare coronary anomaly. If RCA course is not between aortaand pulmonary artery, this anomaly is accepted as rela-tively benign rare anomaly. In case of classic appearenceof ... the left anterior descending artery: a very rare coronary anomaly. Heart Vessels 2002, 16:161-163.13. Kamran M, oga M: Anomalous right coronary artery orginating from the left anterior descending ... pulmonary artery. An intravacular ultrasoundstudy found that luminal compression of the coronary artery was totally attributable to the aorta because thepressure of the pulmonary artery was much...
  • 3
  • 364
  • 0
Báo cáo y học:

Báo cáo y học: "Unstable angina early after aortic valve replacement surgery in a female patient with normal coronary arteries preoperatively – a case report" pot

... angina early after aortic valve replacement in patients with normal coronary arteries in the preoperativeangiography is rare.Generally, possible differential diagnoses of postoperative angina ... bypass surgery andhad an uneventful postoperative recovery.Conclusion Angina pectoris early after aortic valve replacement sur-gery in patients with previously normal coronary arteries may be life ... Left Main Coronary Artery Occlusion after Aortic Aneurysm Repair and Valve Replacement. Chest 1991,99:515-517.5. Tsukiji M, Akasaka T, Wada N, Okahashi N, Kume T, Yoshitani H,Neishi Y, Watanabe...
  • 4
  • 346
  • 0
Báo cáo y học:

Báo cáo y học: "Clear cell variant of diffuse large B-cell lymphoma: a case report." docx

... CAS E REP O R T Open AccessClear cell variant of diffuse large B -cell lymphoma: a case reportSuzana Manxhuka-Kerliu1*, Gordana Petrusevska2, Irma Kerliu3, Emrush Kryeziu4, Fehmi Ahmeti6,Emine ... Devolli-Disha5, Vjollca Sahatciu-Meka6, Sadushe Loxha1and Labinot Shahini1AbstractIntroduction: Diffuse large B -cell lymphoma is a diffuse proliferation of large neoplastic B lymphoid cells ... with a nuclear size equal to or exceeding the normal macrophage nuclei. We report a case of a clear cell variant of diffuse large B -cell lymphoma involving a lymph node in the neck, which was clinically...
  • 6
  • 449
  • 0
Báo cáo y học:

Báo cáo y học: "Successful medical management of emphysematous gastritis with concomitant portal venous air: a case report" docx

... this article as: Paul et al., Successful medical management of emphyse-matous gastritis with concomitant portal venous air: a case report Journal of Medical Case Reports 2010, 4:140 Paul et al. ... of antibiotictherapy covering anaerobes and gram negative bacilli,intravenous hydration and appropriate nutrition is themainstay of treatment. Emphysematous gastritis usuallyhas a fulminant ... distribution, and reproduction in anymedium, provided the original work is properly cited. Case reportSuccessful medical management of emphysematous gastritis with concomitant portal venous air: a case...
  • 4
  • 279
  • 0
Báo cáo y học:

Báo cáo y học: " Atypical clinical presentation of mucopolysaccharidosis type II (Hunter syndrome): a case report" pptx

... presentation of mucopolysaccharidosis type II (Hunter syndrome): a case reportGauri Shankar Shah*, Tania Mahal and Subodh SharmaAbstractIntroduction: We present a very rare case of mucopolysaccharidosis ... manifestation of mucopolysaccharidosis type II (Hunter syndrome). Case presentation: A 10-year-old East Asian boy presented with abdominal distension of five years' duration and complained of ... al., Atypical clinical presentation of mucopoly-saccharidosis type II (Hunter syndrome): a case report Journal of Medical Case Reports 2010, 4:154Received: 28 October 2008 Accepted: 26 May...
  • 4
  • 315
  • 1
Báo cáo y học:

Báo cáo y học: "Laparoscopic-assisted resection of a giant colonic diverticulum: a case report" ppsx

... in a walled off abscess cavity thatgradually enlarges to giant size [7]. Type III contains alllayers of bowel wall and structurally resembles a duplica-tion cyst [7] but is in continuity with ... Italian man initially presented togastroenterologists with a 5-week history of dyspepsia,epigastric pain and a palpable mass in the left hypochron-drium. There was no history of anorexia, dysphagia,weight ... laparoscopic-assisted sigmoid colectomy for treatment of a sympto-matic giant diverticulum. This is the first reported case of laparoscopic-assisted resection of a GCD. Case presentation A 53-year-old...
  • 6
  • 251
  • 0
Báo cáo y học:

Báo cáo y học: " Non-surgical management of recurrent perforation of a jejunal diverticulum following previous segmental bowel resection: a case report" ppt

... first case report of recurrent perforation of a jejunal diverticulum to be successfully managed non-operatively. Case presentation: We report a recurrent perforation of a jejunal diverticulum in an ... rate of jejunal diverticula perforation and how perforated jejunal diverticulaare best managed.IntroductionThis is a rare case of repeated perforations of jejunal diverticula. To the best of ... in an 87-year-oldCaucasian man who presented with a 1-week history of epigastric pain. The diagnosis of a perforated jejunal diverticulum was made from the appearances of the abdominal computed...
  • 4
  • 395
  • 0
Báo cáo y học:

Báo cáo y học: " Successful closed manipulation of a pure lateral traumatic dislocation of the elbow joint using a modified Stimson''''s technique: a case repor" ppt

... CentralPage 1 of 3(page number not for citation purposes)Journal of Medical Case ReportsOpen Access Case report Successful closed manipulation of a pure lateral traumatic dislocation of the elbow ... dislocation of the elbow joint using a modified Stimson's technique: a case reportSameer K Khan*, Rajat Chopra and Debasis ChakravartyAddress: Department of Trauma and Orthopaedics, Peterborough ... choprarajat@hotmail.com; Debasis Chakravarty - debasischakravarty@hotmail.com* Corresponding author AbstractIntroduction: Pure lateral elbow dislocation is rare, and a successful closed reduction is evenrarer....
  • 3
  • 269
  • 0
Báo cáo y học:

Báo cáo y học: "The leading causes of death after burn injury in a single pediatric burn cente" docx

... the majority of pediatric burn patientswas male, had suffered a flame burn injury and had 23% TBSA burn. Inhalation injury was present in 20% of all admittedburns.Respiratory failureRespiratory ... syndrome (ARDS), as defined clini-cally, diffuse alveolar damage (DAD) based solely on findingsat autopsy, aspiration or asphyxia, or asthma attack. ARDSwas clinically defined by meeting four ... 16% of all deaths. Anoxic brain injury accounted for 48% of the brain deaths after burn injury, while cerebral edema with herniation accounted for 52% of the brain deaths. The average TBSA was 62%...
  • 7
  • 265
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012chuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật