Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx
... based on the method byCawthon et al[33]. Briefly, commercially obtained telo-mere specific primers; CGGTTTGT TTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT (forward) and GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT ... 2008,129:60-66.doi:10.1186/1423-0127-18-41Cite this article as: Ngom et al.: Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden. Journal of Biomedical Science ... separate into anaqueous RNA phase, an organic protein layer and a DNA interphase.RNA was extracted by adding 0.5 ml isopropanol tothe aqueous phase and incubating at-20°C overnight,then centri...
- 11
- 527
- 0
Báo cáo y học: "Hepatocyte growth factor ameliorates dermal sclerosis in the tight-skin mouse model of scleroderma" doc
... TGGACCGCAACAACGCCATCTATGA-GAAAACC and TGGAGCTGAAGCAATAGTTGGTATC-CAGGGCT.3. β-actin, TGTGATGGTGGGAATGGGTCAG and TTTGAT-GTCACGCACGATTTCC.Mixed lymphocyte reaction (MLR) and in- vitro cytokine ... determined by normalizingexpression levels to that of β-actin. The primer sequencesused were as follows:1. IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG and CAGTGATGAGGACTTGGACTCATTCATGGTGC.2. TGF-β1, ... and co-ordination of the study, and participated in the interpreta-tion of the results. T Imado and SK performed the animal study and histologic analysis. HS participated in the design of theanimal...
- 7
- 399
- 0
Báo cáo y học: "Trends towards an improved disease state in rheumatoid arthritis over time: influence of new therapies and changes in management approach: analysis of the EMECAR cohort" ppt
... participated in the design of the study and the interpreta-tion of data, and helped to draft the manuscript. MAD per-formed the statistical analysis and helped to draft themanuscript. IG -A participated ... participated in the design of the study and also in collection of the data at the Hospital Universitario de laPrincesa, was involved in the interpretation of data and draftedthe manuscript. All ... whenwe included all DMARD treatments in the model, the effect of the calendar year on activity, disability and damage remainedunchanged – thus reflecting a smaller effect of treatment than of other...
- 10
- 426
- 0
Báo cáo khoa học: Muramyl-dipeptide-induced mitochondrial proton leak in macrophages is associated with upregulation of uncoupling protein 2 and the production of reactive oxygen and reactive nitrogen species docx
... transport of elec-trons through the respiratory chain, increasing the time of interaction between these electrons and molecularoxygen and facilitating the formation of ROS.Activation of innate ... regulatory cycle. Finally, these data suggest theinteresting possibility that UCP2 may serve as an anti-oxidant, guarding against an excess of oxygen free rad-icals. Further studies on signal transduction ... conventionally separated into differentstates. State 2 is the oxygen consumption rate of sub-strate (succinate) oxidation. State 3 is defined as thephosphorylation state and is dependent on the oxygenconsumption...
- 11
- 430
- 0
Báo cáo y học: " Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease" ppt
... anti-host cytotoxic T lymphocyte (CTL) activityEffect of hepatocyte growth factor (HGF) on host B cell activation and donor anti-host cytotoxic T lymphocyte (CTL) activity. Chronic graft-versus-host ... study.TI (Tsuyoshi Iwasaki) conceived of the study, participated in the design and coordination of the study, and participated in the interpretation of the results. JF participated in the HGFgene ... IL-18 treatment generated anti-host CTLs,but did not induce acute GVHD [14]. In contrast to Th1-inducing cytokine treatment, HGF did notgenerate anti-host CTLs in vivo. Although Th1-inducingcytokines...
- 9
- 463
- 0
Báo cáo y học: "Retroviral rebound syndrome after treatment discontinuation in a 15 year old girl with HIV attracted through mother-to-child transmission: case report" doc
... fouryears until she started HAART when it became available1996. At the time she was hospitalized and severely illwith a Mycobacterium avium intracellulare sepsis. Aftertreatment initiation with ... treatment was stopped and thecreatinine concentration normalized again within twomonths.Twelve days after the treatment discontinuation she pre-sented with fever (39–39.5°C), lymphadenopathy,splenomegaly ... syndrome after treatment discontinuation in a 15 year old girl with HIV attracted through mother-to-child transmission: case reportVanda Friman and Magnus Gisslén*Address: Department of Infectious...
- 3
- 579
- 0
Báo cáo y học: " High-grade endometrial stromal sarcoma presenting in a 28-year-old woman during pregnancy: a case report" docx
... microsco-pically normal. Three days later, intestinal obstructionwas diagnosed. We agreed that chemotherapy was notlikely to be a clinical benefit for a high-grade sarcomacausing intestinal obstruction ... cancercomplicating pregnancy. This is a result of t he realiza-tion that oncological treatment modalities, includingsurge ry and chemotherapy, can be applied after t he firstgestational trimester ... involved in the diagnosis and treatment of the patient. All authors provided review and editing of themanuscript. All authors read and approved the final manuscript.Authors’ informationFA is Senior...
- 4
- 189
- 0
Báo cáo y học: "Parotid fistula secondary to suppurative parotitis in a 13-year-old girl: a case report" doc
... produceparotid fistula. There are various treatment options available, however it is necessary to standardize the treatmentaccording to the duration of histor y and the patient’s general condition.Case ... salivary (parotid) fistula was madebased on clinical examination and investigations. The parotid fistula was successfully managed.Conclusion: Parotid fistula secondary to suppurative parotitis ... microscopic magnification. The dye was seenexiting from the natural opening of the Stenson’ sduct,indicating a patent ductal system. An elliptical incision of 1 cm diameter was taken around the fistulous...
- 4
- 289
- 0
Báo cáo y học: "High-grade endometrial stromal sarcoma presenting in a 28-year-old woman during pregnancy: a case report" docx
... cancercomplicating pregnancy. This is a result of t he realiza-tion that oncological treatment modalities, includingsurge ry and chemotherapy, can be applied after t he firstgestational trimester ... upper abdomen. The disease at the level of theperitoneum was infiltrating the sub-peritoneal fat and this infiltration was responsible for the pain at the rightfossa. The uterine serosa was diffusely ... destructive myo-metrial invasion rather than the lymphatic permeation of a low-grade ESS. Moreover, they demonstrate markedcellular pleomorphism and brisk mitotic activity.Tumours that used to...
- 4
- 274
- 0
Báo cáo y học: " Parotid fistula secondary to suppurative parotitis in a 13-year-old girl: a case report" doc
... by glandular atrophy,thus allowing healing of the fistula [1]. Another form of treatment is tympanic nerve section, which has a lowsuccess rate and can take a long time to achieve healing of ... healing of the fistula [1]. The results of the latter two techniquesare comparatively slow and unpredictable [6]. In the case of our patient, as it was a delayed presen-tation, a fistulectomy was performed. ... clinicalcondition.ConsentWritten informed consent was obtained from thepatient’s guardian for publication of this case repor t and any accompanying images. A copy of the written con-sent is avai lable for review by the...
- 4
- 251
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP