0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

GT-repeat polymorphism in the heme oxygenase1 gene promoter and the risk of carotid atherosclerosis related to arsenic exposure ppt

GT-repeat polymorphism in the heme oxygenase1 gene promoter and the risk of carotid atherosclerosis related to arsenic exposure ppt

GT-repeat polymorphism in the heme oxygenase1 gene promoter and the risk of carotid atherosclerosis related to arsenic exposure ppt

... association of arsenic exposure in drinking waterwith an increased risk of carotid atherosclerosis. In this study, we investigated the relationship between HO-1genetic polymorphism and the risk of atherosclerosis ... this article as: Wu et al.: GT-repeat polymorphism in the heme oxygenase-1 gene promoter and the risk of carotid atherosclerosis related to arsenic exposure. Journal of Biomedical Science 2010 ... confounded the relation between the HO-1 genotype and carotid atherosclerosis. In the LMNcohort in the context of high arsenic exposure, the possibility o f an effect from other genes linked to the HO-1...
  • 11
  • 291
  • 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

... also be of interest to examinewhether additional proteins bind to the other three MREs in the WD promoter, and if so, to determine the precisemechanisms by which such proteins modulate WD gene expression.Ó ... Coomassieblue staining, the bands were sliced out of the gel and subjected to automated amino acid sequencing.Construction of the IR Ku-80 gene and the truncatedKu-80 (DKu80)For the double-stranded RNAi ... gene promoter activity in HepG2 cells The relative positions of the MREs within the promoter region of the WD gene are indicated in Fig. 1. The fourMREs are located in the proximal region of the...
  • 11
  • 628
  • 0
Báo cáo khoa học: Mechanism for transcriptional synergy between interferon regulatory factor (IRF)-3 and IRF-7 in activation of the interferon-b gene promoter docx

Báo cáo khoa học: Mechanism for transcriptional synergy between interferon regulatory factor (IRF)-3 and IRF-7 in activation of the interferon-b gene promoter docx

... Benefits of using insect cells to reconstitute the activation of the IFN-b gene Some of the genes encoding factors involved in IFN-bexpression have been inactivated by gene targeting(reviewed in ... teratocar-cinoma line) the failure to activate the IFN-b promoter wasnot due to the absence of the pathway leading to activation of IRF-3 and IRF-7. The e ndogenous levels of IRF-3 and IRF-7 in ... to 1.5% of input and binding to other GST–p300/CBP fusions did not exceed 0.5% of input. By contrast, p65bound strongly to the N-, C1- and C2-regions of p300, and to the N- and C2-regions of...
  • 11
  • 487
  • 0
Báo cáo y học:

Báo cáo y học: "Association of the T+294C polymorphism in PPAR δ with low HDL cholesterol and coronary heart disease risk in women"

... Gotto AM, Marian AJ. Effects of PPARα, γ and δ haplotypes on plasma levels of lipids and progression of coronary atherosclerosis and response to statin therapy in the lipoprotein coronary atherosclerosis ... numerous interacting genes are altered which may influence the effect of PPARδ on metabolism. In our data and in the study by Skogsberg et al., the effect of the C allele on lipid levels increased ... for a gene- to -gene interaction between both genes and exclude the possibility that the observed associations are due to apoE rather than PPARδ in our study. Conflicts of interest The authors...
  • 4
  • 568
  • 0
Báo cáo khoa học: A new rice zinc-finger protein binds to the O2S box of the a-amylase gene promoter pptx

Báo cáo khoa học: A new rice zinc-finger protein binds to the O2S box of the a-amylase gene promoter pptx

... experimental data indicate thatRAMY protein binds specifically to the O2S elemen t. Wehave also determined the importance of the amino acidswithin the binding domain of RAMY protein and analyzed the time ... pLGD17-265UP1wasusedasthebaitwithaninsertion of three copies of the O2S domain at the 5¢ end of the CYC1 mini -promoter region. Following transfor-mation of the URA-marked plasmid pLGD-265 UP1containing the ... was then transferred to Whatman paper16,driedandautoradiographed.ResultsScreening for rice cDNA encoding the O2S bindingprotein To isolate genes whose products bind to the O2S domain(ATTGACTTGACCGTCATCGG)...
  • 7
  • 359
  • 0
Báo cáo y học:

Báo cáo y học: "Abnormalities of B cell phenotype, immunoglobulin gene expression and the emergence of autoimmunity in Sjögren’s syndrome" pdf

... factorsinvolved in directing lymphocytes into inflamed tissue and maintaining inflammation in SS, whereas the etiologicfactors of SS remain to be delineated. Of potential importance is the ... accumulation and retention of these antigen-experienced B cells in the parotids, togetherwith new findings of the role of chemokines and chemokinereceptors, permitted new insight into the immunopathogen-esis ... significant in pSS and have been included in the classification criteria [2]. However, the factors drivingautoimmunity and leading to the differentiation of auto-reactive lymphocytes into autoantibody-producing...
  • 12
  • 351
  • 0
Analysis of Phosphorus Behavior in the Giant Reed for Phytoremediation and the Biomass Production System

Analysis of Phosphorus Behavior in the Giant Reed for Phytoremediation and the Biomass Production System

... experiment using radioactive phosphorus indicated that the decreasing of phosphorus in the leaves occurred in the order of location from the bottom to the top, which is relevant to the order of dying ... utilized in the next year. Based on these findings, a management method adequate to obtain the biomass of the giant reed and maintain the wetland potential is proposed as shown in Fig. 10. In this ... adsorption loss of phosphorus and other changes that occur in soil. The experimental equipment was placed on the rooftop terrace of the Institute of Industrial Science, the University of Tokyo, which...
  • 12
  • 1,043
  • 0
The revolution in philosophy (III) - aesthetic taste, teleology, and the world order

The revolution in philosophy (III) - aesthetic taste, teleology, and the world order

... “morality”had therefore to be joined. The very way in which the beautiful spon-taneously attracts one to it seemed to many to be exactly the kind of internal motivation to leading the moral life ... things. Something like the “kingdom of ends” thus seems to beat play in aesthetic judgment, except that the “kingdom of ends” involves the use of concepts (there are indeed moral rules and reasoned ... see the world as having the purpose within itself to bring about the existence of man as a moral being. Indeed, to see man as a moralbeing is already to impute some kind of purposiveness to him;...
  • 14
  • 499
  • 0
Tài liệu Báo cáo khoa học: The miRNA-192 ⁄194 cluster regulates the Period gene family and the circadian clock doc

Tài liệu Báo cáo khoa học: The miRNA-192 ⁄194 cluster regulates the Period gene family and the circadian clock doc

... absence of afunctional SCN [27]. Therefore, it would be interesting to determine the exact role of miR-192 ⁄ 194 in thesetissues. Together, the identification of inhibitorymiRNAs for the Per genes ... mode of repressionleads to the cycling of BMAL1 mRNA levels in ananti-phase fashion to that of the CCGs. When the other negative regulators of BMAL1, the Per and Cryproteins, are at their ... role in both of these tissues [25,26].Interestingly, both of these tissues have been suggested to be the only ones that are able to maintain circadianrhythms of clock gene expression in the...
  • 9
  • 480
  • 0
Tài liệu Báo cáo khoa học: Bioinformatics of the glycoside hydrolase family 57 and identification of catalytic residues in amylopullulanase from Thermococcus hydrothermalis doc

Tài liệu Báo cáo khoa học: Bioinformatics of the glycoside hydrolase family 57 and identification of catalytic residues in amylopullulanase from Thermococcus hydrothermalis doc

... Accordingly, in our alignment, Asp248 (analogous to residue Asp214 in O32462_THELI and to residue Asp394 in Q9Y8I8_THEHY) is predicted to play the role of protondonor in the P. furiosus a-galactosidase ... sequences belonging to family 57(GH-57) of the glycoside hydrolases were collected using the CAZy server, Pfam database and BLASTtools. Owing to the sequence heterogeneity of the GH-57 members, ... Glu123 and Asp214, which appear to define the catalytic centre of the enzyme. Importantly, the distance betw een the pair of oxygen atoms of Glu123 and Asp214 is appropriate for retaining enzymes...
  • 10
  • 577
  • 0

Xem thêm

Từ khóa: we are seeing a global increase in the prevalence of agerelated disordershave been studied as potential key molecules in the pathogenesis of the precancerous intestinal metaplasia of the human stomach howevera struggle in the race of lifeand an increase in the presentation of the endogenous lectin galectin1 sensing these changes on the surface of p16 ink4a expressing pancreatic carcinoma cells capan1in the orbit of saturntom swift in the land of wondersBáo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015