The miRNA-192 ⁄ 194 cluster regulates the Period gene family and the circadian clock Remco Nagel 1 , Linda Clijsters 1 and Reuven Agami 1,2 1 Division of Gene Regulation, The Netherlands Cancer Institute, Amsterdam, The Netherlands 2 Center for Biomedical Genetics, The Netherlands Introduction Daily oscillations of physiological and behavioural processes can be observed in diverse organisms, rang- ing from the filamentous fungus Neurospora crassa to humans. The oscillating rhythms are driven by an internal timing mechanism called the circadian clock. In mammals, the circadian system is organized as a hierarchical network of molecular clocks that operate in different tissues, with the master clock residing in the suprachiasmatic nucleus (SCN) in the hypothala- mus. The master clock itself is synchronized by means of external cues from the daily light ⁄ dark cycles, and transmits information regarding its phase to multiple tissue-specific clocks [1]. The molecular machinery underlying the circadian rhythm, which is present in each individual cell, is thought to be composed of self- sustaining transcriptional feedback loops. The core of the molecular pathway regulating circadian oscillations is the CLOCK ⁄ BMAL1 complex [2,3]. This hetero- dimeric complex functions as a transcription factor that is able to induce the expression of circadian out- put genes, also called clock-controlled genes (CCGs), via E-box enhancer elements in their promoters [4]. Amongst the CCGs are also the negative regulators of CLOCK ⁄ BMAL1, the family of Period genes (Per1, Per2 and Per3), the Cryptochromes (Cry1 and Cry2) and Rev-Erb a [3,5,6]. Rev-Erba binds the BMAL1 promoter directly to inhibit BMAL1 transcription, resulting in reduced CLOCK ⁄ BMAL1 levels and decreased CCG expression [7]. This mode of repression leads to the cycling of BMAL1 mRNA levels in an anti-phase fashion to that of the CCGs. When the other negative regulators of BMAL1, the Per and Cry proteins, are at their peak levels in the nucleus, they function in complexes to suppress E-box-dependent gene activation [5]. In this way, the molecular circa- dian clock is reset and a new cycle can be started. In addition to transcriptional regulation, several studies have shown that post-transcriptional processes Keywords circadian clock; miRNA-192; miRNA-194; Period gene family Correspondence R. Agami, Division of Gene Regulation, The Netherlands Cancer Institute, Plesmanlaan 121, 1066CX, Amsterdam, The Netherlands Fax: +31(0)20 512 1999 Tel: +31(0)20 512 2079 E-mail: r.agami@nki.nl (Received 17 June 2009, revised 15 July 2009, accepted 22 July 2009) doi:10.1111/j.1742-4658.2009.07229.x Several biological functions in mammals are regulated in a circadian fash- ion. The molecular mechanisms orchestrating these circadian rhythms have been unravelled. The biological clock, with its core transcriptional unit Bmal1 ⁄ CLOCK, is composed of several self-sustaining feedback loops. In this study, we describe another mechanism impinging on the core compo- nents of the circadian clock. Using a forward genetic screen, we identified the miR-192 ⁄ 194 cluster as a potent inhibitor of the entire Period gene family. In accordance, the exogenous expression of miR-192 ⁄ 194 leads to an altered circadian rhythm. Thus, our results have uncovered a new mech- anism for the control of the circadian clock at the post-transcriptional level. Abbreviations CCG, clock-controlled gene; Cry, Cryptochrome; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; miRNA, microRNA; Per, Period; SCN, suprachiasmatic nucleus. FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 5447 are of major importance in the control of the circadian clock. The phosphorylation and degradation of Per proteins have been suggested to control timing of the mammalian clock [8]. Moreover, BMAL1 and Cry proteins are subject to phosphorylation, SUMOylation and proteasomal degradation, thereby controlling their activity at the post-transcriptional level [9–11]. Recently, a new class of post-transcriptional regula- tors, called microRNAs (miRNAs), has been shown to possess regulatory functions towards the circadian clock. miRNAs are single-stranded, nonprotein-coding RNA molecules, approximately 19–25 nucleotides in length. By binding to the complementary sites in the 3¢UTRs of their target genes, they can induce transla- tional inhibition or mRNA decay. miRNAs have been shown to be involved in many cellular processes, including the control of the circadian clock [12]. In a comprehensive study, Cheng et al. [12] showed that miR-132 and miR-219 are expressed rhythmically in the SCN and are bona fide CCGs. Interestingly, miR- 219 was shown to fine tune the length of the circadian period in mice, whereas miR-132 was suggested to be a negative regulator of the light-dependent resetting of the clock itself. In this study, we have uncovered a role for a cluster of miRNAs in the control of core components of the circadian clock. Using a forward genetic screen to dis- cover miRNAs with regulatory capacities towards the 3¢UTRs of all the Per family members (Per1, Per2 and Per3), we identified an miRNA cluster containing miR-192 and miR-194 (miR-192 ⁄ 194) as powerful reg- ulators. The strong expression level of this cluster potently inhibits the synthesis of all three Per mem- bers, resulting in an altered circadian rhythm. Results miR-192 and miR-194 target all three Per genes In order to identify miRNA regulators of the Per gene family members, Per1, Per2 and Per3, we cloned their respective 3¢UTRs downstream of a green fluorescent protein (GFP) coding sequence in a sensor vector described previously [13,14]. The constructed vectors were delivered retrovirally to HeLa cells, after which single clones with a defined level of GFP expression were isolated. The constructed cell lines were subse- quently transduced with a microRNA expression library (miR-Lib; [13]) in a single-well format, drug selected and pooled. To identify possible regulatory miRNAs towards the inserted 3¢UTRs, the three pools of cells containing one unique GFP reporter were fluo- rescence-activated cell sorted on their GFP expression levels. The relative abundance of miRNA inserts between the low-GFP-expressing population and the total population was measured by a barcode-type anal- ysis using our miRNA arrays. We observed in the resulting M–A plots that only a few miRNAs were reproducibly enriched in the low-GFP-expressing pop- ulation (Fig. 1A–C). The most striking observation was that the most highly enriched miRNA expression vector (miR-Vec) for all three individual 3¢UTRs was the vector encoding the miR-192 ⁄ 194 cluster (Fig. 1A–F). To confirm that the obtained hits from the GFP UTR screens indeed have regulatory capacities against the 3¢UTR of the Per genes, we retested their effects on the original HeLa cell line expressing the GFP sen- sor constructs. We observed that miR-192 ⁄ 194 inhib- ited GFP expression of all the sensor constructs, whereas all the other obtained hits could not signifi- cantly downregulate any of the GFP-Per sensors (Fig. 2A–C and data not shown). To exclude the possi- bility that miR-192 ⁄ 194 regulates a common sequence in the GFP sensor construct, we subcloned the 3¢UTR of Per1–3 into a luciferase vector. In addition, these vectors were reduced by about 30% in comparison with the control, indicating that the sequences regu- lated by miR-192 ⁄ 194 indeed reside in the 3¢UTRs of the Per1–3 genes (Fig. 2D). A close examination of the 3¢UTR of the Per genes by TargetScanHuman 5.0 [15] revealed that all of these sequences harbour putative target sites for miR-192 or miR-194. Whereas the Per1 3¢UTR contains one predicted target site for miR-194, Per2 has a site for miR-192 as well as miR-194, and Per3 harbours one putative site for miR-192 and two for miR-194 (Fig. 3A). As predicted, all of these target sites are well conserved between mammalian species, implying a pos- sible common regulatory mechanism. To show that the miR-192 ⁄ 194 cluster indeed regulates the 3¢UTRs of the Per genes via these predicted target sites, we mutated all of these sequences. In transient transfec- tion experiments, these mutated 3¢UTRs were com- pletely refractory to regulation by the miR-192 ⁄ 194 cluster, indicating the direct suppression of Per1, 2 and 3 by these miRNAs (Fig. 3B–D). Together, these data indicate that the miR-192 ⁄ 194 cluster is a potent and direct regulator of the Per gene family. Endogenously expressed miR-192 ⁄ 194 represses Per As it has been reported previously that miR-192 ⁄ 194 is highly expressed in colorectal cancer cell lines and tumours [16], we attempted to exploit these cells to Regulation of the circadian clock by miR-192 ⁄ 194 R. Nagel et al. 5448 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS determine the endogenous role of miR-192 ⁄ 194. The examination of 12 colorectal cell lines indicated a het- erogeneous level of miR-192 ⁄ 194, ranging from very low in HCT116, Colo320 and SW48 cells, to high in LOVO, HT29 and LS174T cells (Fig. S1, see Support- ing information). We made use of the different Per luciferase 3¢UTR constructs to detect miR-192 ⁄ 194 activity. In transient transfection assays with these con- structs containing wild-type and mutant Per 3¢UTRs, we observed reduced expression of all three wild-type 3¢UTRs only in cell lines with strong expression of endogenous miR-192 ⁄ 194 (LOVO, HT29, Fig. 4A). In HCT116 cells, which do not express miR-192 ⁄ 194, no such difference between wild-type and mutant 3¢UTRs was observed. This result indicates that miR-192 ⁄ 194 expression is a prominent determinant for Per 3¢UTR regulation in these cells. To explore this further, we transfected anti-miR RNA oligos targeting miR- 192 ⁄ 194 or a control miRNA, miRNA-372. Whereas the transfection of anti-miR-192 ⁄ 194 completely abol- ished the miR-192 ⁄ 194-dependent regulation of Per1 3¢UTR in HT29 cells, transfection of the control anti- miR left it intact (Fig. 4B). Together, these results show that endogenously expressed miR-192 ⁄ 194 also suppresses the synthesis of Per proteins. miR-192 ⁄ 194 overexpression alters the circadian rhythm Deregulation of Per genes in mice has been shown to reduce the length of the circadian period. As the downregulation of all three Per genes by miR-192 ⁄ 194 could potentially have a similar effect on period length, we overexpressed the miR-192 ⁄ 194 cluster in NIH3T3 cells to identify its effect on the circadian cycle. In NIH3T3 cells, miR-192 and miR-194 are almost undetectable (Fig. 5A). As expected, the intro- duction of miR-Vec-192 ⁄ 194 in these cells resulted in a strong expression level of both miRNAs (Fig. 5A). This level of expression, however, was comparable with endogenous miR-192 ⁄ 194 observed in human colorectal cell lines (Fig. 5B). AD BE CF Fig. 1. Identification of miR192 ⁄ 194 regula- tory capacities towards the Per gene family using a forward genetic screen. (A–C) Representative M–A plots of the Per1, Per2 and Per3 screens, respectively. Each graph shows the relative abundance of each indi- vidual miRNA insert in the low and total GFP populations. The top outlier (miR-Vec- 192–194 cluster) is encircled. (D–F) Tables showing the top five miRNA outliers, which are more abundant in the low-GFP popula- tion from a duplicate screen on the Per1, Per2 and Per3 3¢UTRs, respectively. R. Nagel et al. Regulation of the circadian clock by miR-192 ⁄ 194 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 5449 Subsequently, we made use of the engineered NIH3T3 cells expressing miR-192 ⁄ 194 to determine the effects on the circadian cycle by monitoring BMAL1 mRNA levels. As described previously, levels of BMAL1 mRNA oscillate in a circadian fashion in time following serum shock. Examination of BMAL1 mRNA oscillation over a time course of 64 h revealed A B C D * * * Fig. 2. Validation of the effect of miR-192 ⁄ 4 on the Per 3¢UTRs. (A–C) Verification of the effect of miR-192 ⁄ 194 on GFP expression in HeLa-GFP-UTR constructs of Per1, Per2 and Per3 3¢UTRs, res- pectively. Graphs depicting the GFP expression of the control and miR-Vec-192 ⁄ 4 are shown in different colours. (D) Luciferase assay showing the effect of miR-192 ⁄ 194 expression on luciferase con- structs coupled to the Per 3¢UTRs. Values represent a triplicate assay, in which the data are represented as the standardized mean ± standard error of the mean (SEM). *Significant difference when compared with the control (P < 0.01), as determined by a two- tailed t-test. All experiments are representative of a triplicate repeat. * * * A B C D Fig. 3. Mutational analysis of Per 3¢UTRs shows direct regulation by miR-192 ⁄ 194. (A) Schematic representation of the 3¢UTR of the Per genes. The different target sites for miR-192 ⁄ 194 are indicated. (B–D) Dual luciferase assay showing the effect of miR-192 ⁄ 194 on the 3¢UTRs of Per1, 2 and 3, respectively, in both the wild-type and mutated form. Values represent a triplicate assay, in which the data are represented as the standardized mean ± standard error of the mean (SEM). *Significant difference when compared with the control (P < 0.01), as determined by a two-tailed t-test. Regulation of the circadian clock by miR-192 ⁄ 194 R. Nagel et al. 5450 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS a reproducible alteration of the circadian rhythm in cells expressing miR-192 ⁄ 194 compared with control cells. (Figs 5C, S2, see Supporting information). These data suggest that the expression of miR-192 ⁄ 194 short- ens the length of the circadian period in a cellular system through the simultaneous inhibition of all Per genes. Discussion Using a target-based screening technique, we have uncovered a new method of regulation of core compo- nents of the circadian clock. We identified the miR- 192 ⁄ 194 cluster as a potent regulator of the entire Per gene family, which consists of Per1, Per2 and Per3. This finding depicts a direct regulation of core compo- nents of the circadian clock. Strikingly, exogenous overexpression of miR-192 ⁄ 194 leads to an altered circadian cycle. miRNAs and the circadian clock Since the discovery of the molecular mechanism regu- lating circadian rhythms, it has been recognized that tight transcriptional control is essential for correct cir- cadian cycling [17]. Recently, post-transcriptional events have also been implicated in the control of the circadian clock [8–11]. Not surprisingly, miRNAs have also been shown to possess regulatory capacities on the circadian rhythm [12]. It has been suggested that miR-219 and miR-132 are capable of shortening the circadian period and negatively regulating the light- dependent resetting of the clock, respectively [12]. However, amongst the target genes suggested for these two miRNAs, which are regulated in a circadian fash- ion, no core components of the circadian clock were found. This suggests that these miRNAs affect the cir- cadian clock via indirect mechanisms. The identifica- tion of the miR-192 ⁄ 194 cluster as a potent regulator of the Per gene family, however, shows that the core clock proteins are also under post-transcriptional control exerted by miRNAs. miRNAs and the circadian cycle miR-219 is capable of shortening the circadian period by 10–20 min [12]. The exact mechanism by which this miRNA is able to alter the circadian period, however, still remains to be examined. In addition to this, the data presented here show that miR-192 ⁄ 194 expression also affects the circadian cycle, potentially through the downregulation of the entire Per gene family. Additional quantitative experiments on the observed alteration of the circadian rhythm need to show whether this effect is caused by a shortening of the circadian period length or by a phase shift phenotype. At present, we cannot exclude the possibility that miR-192 ⁄ 194 has additional targets other than the Per genes that assist in the regulation of the circadian clock. However, the alteration of the circadian rhythm seems to be in good agreement with the effects of knockout studies of the individual Per family members in mice. Knockout of Per1, Per2 and Per3 in mice leads to a shortening in circadian period of about 1, 1.5 and 0.5 h, respectively [18–20]. Our results suggest that partial inhibition of all Per genes by miR-192 ⁄ 194 may achieve a similar effect on the circadian clock as the complete loss of individual Per genes. P < 0.01 A B Fig. 4. The effect of endogenously expressed miR-192 ⁄ 194 on Per genes. (A) Luciferase assay showing the relative expression of luciferase genes coupled to the Per 3¢UTRs in different cell lines. Values represent a triplicate assay, in which the data are repre- sented as the standardized mean ± standard error of the mean (SEM). HCT116 cells express low levels of miR-192 ⁄ 194, whereas LOVO and HT29 cells express high levels of this miRNA cluster. (B) Dual luciferase assay showing the effect of inhibition of miR- 192 ⁄ 194 in cells endogenously expressing this miRNA cluster (HT29) in comparison with control cells. Values represent a tripli- cate assay, in which the data are represented as the standardized mean ± SEM. R. Nagel et al. Regulation of the circadian clock by miR-192 ⁄ 194 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 5451 Regulation of the miR-192 ⁄ 194 cluster It has been reported that miRNA-192 and miR-194 can be induced by several factors, such as hepatocyte nuclear factor-1a and p53 [21–23]. This suggests that different cellular processes might affect the circadian clock, for example genotoxic stresses that activate p53. It has been proposed that the expression of most CCGs peaks just before dawn and appears to prepare for the stress caused by daily sun exposure [24]. Specu- lating on this, the induction of miR-192 ⁄ 194 by acti- vated p53 might be a means for cells to adjust the circadian time to the level of radiation they encounter. The observation that miR-192 and miR-194 are both highly expressed in liver and kidney implies that these miRNAs play a role in both of these tissues [25,26]. Interestingly, both of these tissues have been suggested to be the only ones that are able to maintain circadian rhythms of clock gene expression in the absence of a functional SCN [27]. Therefore, it would be interesting to determine the exact role of miR-192 ⁄ 194 in these tissues. Together, the identification of inhibitory miRNAs for the Per genes adds more complexity to the mode of regulation of core components of the circadian clock and the clock itself. Experimental procedures Cell culture HeLa, NIH3T3, CaCo2, Colo205, Colo320, DLD1, HCT116, HCT15, HT29, LOVO, LS174T, SW48, SW480, WiDr and EcoPack cells were cultured in Dulbecco’s modi- fied Eagle’s medium supplemented with 10% fetal bovine serum and antibiotics. The serum shock to induce circadian cycling of NIH3T3 cells was carried out as described previ- ously [28]. In short, approximately 5 · 10 5 cells were plated in a six-well plate, which was left for 3 days in normal med- ium. Subsequently, the medium was replaced with medium containing 1% serum for 2 days. At time 0, the medium A B C Fig. 5. The effect of altered miR-192 ⁄ 194 expression on the circadian cycle. (A) Relative expression of miR-192 ⁄ 194 in NIH3T3 cells stably transduced with miR-Vec-192 ⁄ 4, as determined by quantitative PCR. (B) Comparison of the miRNA levels in a set of colorectal cell lines and NIH3T3 cells overexpressing miR-192 ⁄ 194. NIH3T3) is the control cell line and NIH3T3+ indicates the cells overexpressing miR-192 ⁄ 194. (C) Graph showing the periodicity of Bmal1 mRNA levels in NIH3T3 cells with high levels of miR-192 ⁄ 194 and control cells, as determined by quantitative PCR. All data here represent triplicate PCRs, in which the data are represented as the standardized mean. The graph shown is a representative experiment from a duplicate repeat. Regulation of the circadian clock by miR-192 ⁄ 194 R. Nagel et al. 5452 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS was exchanged for medium containing 50% horse serum. After 2 h, this medium was replaced with serum-free medium and the cells were harvested at the indicated time points. Constructs GFP-Per1-3¢UTR, GFP-Per2-3¢UTR and GFP-Per3-3¢UTR were constructed by cloning the 3¢UTR of the respective Per genes between Eco RI and BamHI restriction sites of the GFP sensor vector, as described in [13]. The 3¢UTRs of Per1, 2 and 3 were amplified from genomic DNA using the following primers: Per1 forw, GAATTCTTAAACTCC ATTCTGGGACCATCTCC; Per1 rev, AGATCTGGCGT TTTTATCTTTTTGTATT; Per2 forw, GAATTCTTAAC AGCCAGCGAGGTACACCAGGTGG; Per2 rev, GGA TCCGGCAAACAGGTCATAAAAAGACAC; Per3 forw, GAATTCTTAAGTGACTGTGAGGATGAACCTTC; Per3 rev, GGATCCTCACGTTTTACATGTACAGAGTTTA. Luc-Per1-3¢UTR, Luc-Per2-3¢UTR and Luc-Per3-3¢UTR were produced by subcloning of the 3¢UTR of Per into the pGL3 vector (Promega) downstream of the luciferase gene by means of PCR. The primers used for this PCR were as follows: Per1 forw, GCGACGTCTTAAACTCCATTC TGGGACCATCTCC; Per1 rev, GCACCGGTGGCGTTT TTATCTTTTTGTATT; Per2 forw, GCGACGTCTTAAC AGCCAGCGAGGTACACCAGGTGG; Per2 rev, GCAC CGGTGGCAAACAGGTCATAAAAAGACAC; Per3 fo- rw, GCGACGTCTTAAGTGACTGTGAGGATGAAC CTTC; Per3 rev, GCACCGGTTCACGTTTTACATGTA CAGAGTTTA. Mutants of the Per 3¢UTR luciferase reporters were constructed using the QuickChangeÒ Multi Site-Directed Mutagenesis Kit (Stratagene), according to the manufacturer’s protocol. Luc-Per1-3¢UTR-Mut was cre- ated using the following primer: GGCGTTTTTATCT TTTTGTATTAAAAAAGTAGGGATCCACACAAATAT CAAAAACACAA. The two mutations in Luc-Per2- 3¢UTR-Mut were established using the following primers: GGTAGCAGTCTGCATTCTTATGGCCATTAGAAAAA CAAAACTCCTTGCCTCTAAAGTCAGATCATGAA and GCCTCTGCCAGTGTCCCCAGCACTTTTCAAAACTTT GGACACTTGGGGAAAAGTGAGG. Luc-Per3-3¢UTR- Mut contains three mutated target sites which were gener- ated using the following primers: GGATGAACCTTCA TACCCTTTCCAAGACGAAAACAACAGACAGACCTT TTTAAGTCCTGGACTT, GAGCCCCAAACCTTAGCCT CATTTATTTTGTTCAAAACAATAAGTCATTTTCCCC TTAGAGTGCTTGAAGAA and CATGAATGTTACCC AAAAAGCTGTGTTTTCTTTGGTCAGCAAAACAAAT TTATGAAAAACAAAATGCTGTATGAATGGAAATCA. Luciferase assay Luciferase assays were performed using HeLa cells, which were transfected using Fugene (Roche). For Luc-Per- 3¢UTR reporter assays, cells were cultured in 24-well plates and transfected with 5 ng of Luc-Per-3¢UTR (or mutant constructs), 5 ng of Renilla and 0.5 lg of miR- Vec-192 ⁄ 4. The colorectal cell lines were transfected in the same manner as described for HeLa cells, except that Lipofecta- min2000 (Invitrogen) was used as transfection reagent. The anti-miRs were transfected in an amount of 0.5 lg for a 24-well plate. The anti-miR sequences used were as follows: control, Chl-CGGUGACGCUCAAAUGUCGCAGCAC UUUCCACU; anti-miR-192, Chl-GCACUGGCUGU CAAUUCAUAGGUCAGAGCCC; anti-miR-194, Chl- GACAGUCCACAUGGAGUUGCUGUUACACUUGA. For these experiments, 10–20 ng of Luc-Per-3¢UTR (or mutant constructs) and 2.5 ng of Renilla were used. Flow cytometry The separation of low-GFP-expressing miR-Lib-containing cells was performed by cell sorting using the FACSAria cell sorter from Becton Dickinson. The validation of miRNA hits was performed as described previously, using HeLa cells stably expressing GFP-Per-3¢UTR [13]. Quantitative RT-PCR and real-time TaqMan PCR Total RNA was extracted from cell lines using TRIzol reagent, according to the manufacturer’s protocol. The syn- thesis of cDNA with Superscript III reverse transcriptase (Invitrogen) was primed with random hexamers. The prim- ers used for the detection of Bmal1 levels (Fwd, GGCCGAATGATTGCTGAGGAAATCATGG; Rev, TTACAGCGGCCATGGCAAGTCACTAAAG) and glyc- eraldehyde-3-phosphate dehydrogenase (GAPDH) (Fwd, CATCCACTGGTGCTGCCAAGGCTGT; Rev, ACAACC TGGTCCTCAGTGTAGCCCA) were designed to amplify 100–200 bp fragments. Analyses were carried out using SYBR Green PCR Master Mix (Applied Biosystems) and the ABI Prism 7000 system (Amersham-Pharmacia). The results were normalized with respect to GAPDH expres- sion. The mRNA levels were quantified according to the DDCt method. TaqManÒ microRNA assays (Applied Biosystems), which include RT primers and TaqMan probes, were used to quantify the expression of mature miRNA-192 (AB: 4373108) and miRNA-194 (AB: 4373106). Gene expression was calculated relative to 18S rRNA (AB: 4333760F). Acknowledgements This work was supported by the Dutch Cancer Society (KWF), the European Young Investigator Programme and the Centre of Biomedical Genetics (CBG). R. Nagel et al. Regulation of the circadian clock by miR-192 ⁄ 194 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 5453 References 1 Schibler U & Sassone-Corsi P (2002) A web of circa- dian pacemakers. Cell 111, 919–922. 2 Gekakis N, Staknis D, Nguyen HB, Davis FC, Wilsbacher LD, King DP, Takahashi JS & Weitz CJ (1998) Role of the CLOCK protein in the mammalian circadian mechanism. Science 280, 1564–1569. 3 Rutila JE, Suri V, Le M, So WV, Rosbash M & Hall JC (1998) CYCLE is a second bHLH-PAS clock pro- tein essential for circadian rhythmicity and transcription of Drosophila period and timeless. Cell 93, 805–814. 4 Ripperger JA & Schibler U (2006) Rhythmic CLOCK- BMAL1 binding to multiple E-box motifs drives circa- dian Dbp transcription and chromatin transitions. Nat Genet 38, 369–374. 5 Darlington TK, Wager-Smith K, Ceriani MF, Staknis D, Gekakis N, Steeves TD, Weitz CJ, Takahashi JS & Kay SA (1998) Closing the circadian loop: CLOCK- induced transcription of its own inhibitors per and tim. Science 280, 1599–1603. 6 Zylka MJ, Shearman LP, Weaver DR & Reppert SM (1998) Three period homologs in mammals: differential light responses in the suprachiasmatic circadian clock and oscillating transcripts outside of brain. Neuron 20, 1103–1110. 7 Preitner N, Damiola F, Lopez-Molina L, Zakany J, Duboule D, Albrecht U & Schibler U (2002) The orphan nuclear receptor REV-ERBalpha controls circadian transcription within the positive limb of the mammalian circadian oscillator. Cell 110, 251–260. 8 Toh KL, Jones CR, He Y, Eide EJ, Hinz WA, Virshup DM, Ptacek LJ & Fu YH (2001) An hPer2 phosphory- lation site mutation in familial advanced sleep phase syndrome. Science 291, 1040–1043. 9 Eide EJ, Vielhaber EL, Hinz WA & Virshup DM (2002) The circadian regulatory proteins BMAL1 and cryptochromes are substrates of casein kinase Iepsilon. J Biol Chem 277, 17248–17254. 10 Siepka SM, Yoo SH, Park J, Song W, Kumar V, Hu Y, Lee C & Takahashi JS (2007) Circadian mutant Overtime reveals F-box protein FBXL3 regulation of cryptochrome and period gene expression. Cell 129, 1011–1023. 11 Cardone L, Hirayama J, Giordano F, Tamaru T, Palvimo JJ & Sassone-Corsi P (2005) Circadian clock control by SUMOylation of BMAL1. Science 309, 1390–1394. 12 Cheng HY, Papp JW, Varlamova O, Dziema H, Russell B, Curfman JP, Nakazawa T, Shimizu K, Okamura H, Impey S et al. (2007) microRNA modulation of circa- dian-clock period and entrainment. Neuron 54, 813–829. 13 le Sage C, Nagel R, Egan DA, Schrier M, Mesman E, Mangiola A, Anile C, Maira G, Mercatelli N, Ciafre SA et al. (2007) Regulation of the p27(Kip1) tumor suppressor by miR-221 and miR-222 promotes cancer cell proliferation. EMBO J 26, 3699–3708. 14 Nagel R, le Sage C, Diosdado B, van der Waal M, Oude Vrielink JA, Bolijn A, Meijer GA & Agami R (2008) Regulation of the adenomatous polyposis coli gene by the miR-135 family in colorectal cancer. Cancer Res 68, 5795–5802. 15 Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP & Bartel DP (2007) MicroRNA targeting speci- ficity in mammals: determinants beyond seed pairing. Mol Cell 27, 91–105. 16 Bandres E, Cubedo E, Agirre X, Malumbres R, Zarate R, Ramirez N, Abajo A, Navarro A, Moreno I, Monzo M et al. (2006) Identification by real-time PCR of 13 mature microRNAs differentially expressed in colorectal cancer and non-tumoral tissues. Mol Cancer 5, 29. 17 Loros JJ & Dunlap JC (1991) Neurospora crassa clock- controlled genes are regulated at the level of transcrip- tion. Mol Cell Biol 11, 558–563. 18 Zheng B, Larkin DW, Albrecht U, Sun ZS, Sage M, Eichele G, Lee CC & Bradley A (1999) The mPer2 gene encodes a functional component of the mammalian circadian clock. Nature 400, 169–173. 19 Zheng B, Albrecht U, Kaasik K, Sage M, Lu W, Vaish- nav S, Li Q, Sun ZS, Eichele G, Bradley A et al. (2001) Nonredundant roles of the mPer1 and mPer2 genes in the mammalian circadian clock. Cell 105, 683–694. 20 Shearman LP, Jin X, Lee C, Reppert SM & Weaver DR (2000) Targeted disruption of the mPer3 gene: sub- tle effects on circadian clock function. Mol Cell Biol 20, 6269–6275. 21 Hino K, Tsuchiya K, Fukao T, Kiga K, Okamoto R, Kanai T & Watanabe M (2008) Inducible expression of microRNA-194 is regulated by HNF-1alpha during intestinal epithelial cell differentiation. RNA 14, 1433– 1442. 22 Braun CJ, Zhang X, Savelyeva I, Wolff S, Moll UM, Schepeler T, Orntoft TF, Andersen CL & Dobbelstein M (2008) p53-Responsive microRNAs 192 and 215 are capable of inducing cell cycle arrest. Cancer Res 68, 10094–10104. 23 Georges SA, Biery MC, Kim SY, Schelter JM, Guo J, Chang AN, Jackson AL, Carleton MO, Linsley PS, Cleary MA et al. (2008) Coordinated regulation of cell cycle transcripts by p53-inducible microRNAs, miR-192 and miR-215. Cancer Res 68, 10105–10112. 24 Correa A, Lewis ZA, Greene AV, March IJ, Gomer RH & Bell-Pedersen D (2003) Multiple oscillators regu- late circadian gene expression in Neurospora. Proc Natl Acad Sci USA 100, 13597–13602. 25 Sun Y, Koo S, White N, Peralta E, Esau C, Dean NM & Perera RJ (2004) Development of a micro-array to detect human and mouse microRNAs and characteriza- tion of expression in human organs. Nucleic Acids Res 32, e188. Regulation of the circadian clock by miR-192 ⁄ 194 R. Nagel et al. 5454 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 26 Tang X, Gal J, Zhuang X, Wang W, Zhu H & Tang G (2007) A simple array platform for microRNA analysis and its application in mouse tissues. RNA 13, 1803–1822. 27 Guo H, Brewer JM, Champhekar A, Harris RB & Bittman EL (2005) Differential control of peripheral circadian rhythms by suprachiasmatic-dependent neural signals. Proc Natl Acad Sci USA 102, 3111–3116. 28 Balsalobre A, Damiola F & Schibler U (1998) A serum shock induces circadian gene expression in mammalian tissue culture cells. Cell 93, 929–937. Supporting information The following supplementary material is available: Fig. S1. Relative expression levels of miR-192 ⁄ 194 in colorectal cell lines. Fig. S2. Reproduction of the data shown in Fig. 5C, revealing the effect of altered miR-192 ⁄ 194 expression on the circadian cycle. This supplementary material can be found in the online article. Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors. R. Nagel et al. Regulation of the circadian clock by miR-192 ⁄ 194 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 5455 . The miRNA-192 ⁄ 194 cluster regulates the Period gene family and the circadian clock Remco Nagel 1 , Linda Clijsters 1 and Reuven Agami 1,2 1. Agami 1,2 1 Division of Gene Regulation, The Netherlands Cancer Institute, Amsterdam, The Netherlands 2 Center for Biomedical Genetics, The Netherlands Introduction Daily