0
  1. Trang chủ >
  2. Thể loại khác >
  3. Tài liệu khác >

346 Biomass – Detection, Production and Usage live yeast biomass for the leavening of bread docx

Báo cáo y học:

Báo cáo y học: "Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes"

... β-glucosidases in the intestine and can be adminis-tered orally [27]. Therefore, the aim of the present study was to evaluate the inhibitory effect of some thioglycosides synthesized in our ... Paper Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes Francisco Castaneda1, Antje Burse2, Wilhelm Boland2, Rolf ... laboratory on human hSGLT1 and hSGLT2 as a potential therapeutic alternative for the control of hyperglycemia, particularly for people with diabetes. We chose to analyze the inhibitory effect of...
  • 9
  • 650
  • 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

... article, a conceptual framework is proposed for the management of public health and social issue behaviors. The articlerelies on education, marketing, and law as its three primary classes of strategic ... canconsider variables relevant to the selection of education,marketing, and law as sets of tools that can be brought tobear on the management of public health and social issue behaviors. The article ... the Management of Public Health and Social Issue Behaviors The author presents a framework that considers public health and social issue behaviors and is based on self-interest,exchange, competition,...
  • 14
  • 780
  • 0
The importance of project management in small- and medium-sized enterprises (SMEs) for the development of new products through E-collaboration docx

The importance of project management in small- and medium-sized enterprises (SMEs) for the development of new products through E-collaboration docx

... the progression to reduce time and cost in developing new products in SMEs. To understand the importance of coordinating these sections with the project manager and validated the model, the ... development by the project manager through e-collaboration. Project management process All projects have a beginning and an ending, and project management has corresponding initiating ... terms of reducing time and cost through electronic collaboration (E-collaboration) and project management. The concept and value of E-collaboration and project management, and its strengths and...
  • 12
  • 980
  • 0
Báo cáo khoa học: Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues doc

Báo cáo khoa học: Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues doc

... Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues Marilyne Stuart-Audette1, ... technique. The bityrosine signal was observed in allpeptides containing tyrosine 23 or 53 but not in peptidescontaining tyrosine 20 alone. According to these results,tyrosines 23 and 53 could be involved ... Tyr20 and 53 give bityrosine.Tyr23 appears not to be involved in the process. Thus newfeatures of long-range intramolecular electron transfer in proteins appear: it is only partial and other...
  • 7
  • 474
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... PCRprimersSequenceCapture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGCCCATTACAATATTGTAACCTTTTGTTGCAAGTGTGACTCTACGCTTCGGT-3Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGCACAGAGCTGCAAACAACTA-3Type-specific ... Open Access A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNAWang Yu-Hong1†, Chen Rui2† and Li Ding3*AbstractBackground: The recent advance in nanomaterial ... clinical samples and part of molecular diagnostic study. LDconceived of the study, and participated in its design, performed the preparation of nanomaterials and the statistical analysis. All authors...
  • 9
  • 469
  • 0
Báo cáo khoa học nông nghiệp

Báo cáo khoa học nông nghiệp " Using FFS to enhance farmers'''' knowledge and skills in citrus production management in the process of implementing GAP in the South of Vietnam " docx

... research so the input of Australian staff in the actual training program of TOT was minimal and did not warrant inclusion in the cost of the training. GAP Workshop in Binh Thuan (21-22/7/2008) ... days and seminars are the best way of communicating new knowledge to farmers with 46.1% farmers nominating these methods in the MD and 54.9 % in the CC. Only 11.2% farmers in the MD and 8.9% in ... closer to mandarins. If King oranges were grouped with Tieu mandarins, then together they would be the dominant group of citrus in MD followed very closely by pomelo. In CC orange is the dominant...
  • 13
  • 522
  • 0
Báo cáo khoa học nông nghiệp

Báo cáo khoa học nông nghiệp " The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS2 " potx

... improvement and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam (009/05VIE) in Vietnam during the period ... The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam MS2: FIRST SIX-MONTHLY ... development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam (009/VIE05) Vietnamese Institution Goat...
  • 12
  • 541
  • 0
Project Progress Report: The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS3

Project Progress Report: The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS3 " doc

... initiation of activities for the CARD project The improvement and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region ... observed in the system. 13 1. Institute Information Project Name The development and implementation of new appropriate technologies for improving goat production and increasing small-holder ... overcome, thereby improving the income and well-being of farming communities in these areas. The following report presents information collected on the Goat Production Baseline (Output 1.1, 1.2 and...
  • 13
  • 658
  • 0
The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - Milestone 9

The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - Milestone 9" pot

... Rural Development Project Progress Report The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region ... improving goat production and increasing small-holder income in the central region of Vietnam . This is a program which includes elements of farm survey, strategic planning for improving health and ... following the introduction of new technologies to farmers in Ninh Thuan, Binh Thuan and Lam Dong provinces of southeast Vietnam. The title of the report is New technologies for Improving Goat Production...
  • 9
  • 376
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Neural Mechanisms of Motion Detection, Integration, and Segregation: From Biology to Artificial Image Processing Systems" docx

... on Advances in Signal Processing 6. Summary and ConclusionWe presented a model of motion processing in areas V1 and MT capable of handling synthetic as well as artificial image sequences. The ... modelling of neural mechanisms (functionality) and their interaction is motivated by prin-ciple findings of electrophysiology, anatomical studies, and theories of information processing of macaque ... comparison to other existing models of motion processing, both from biology and technical computer vision approaches.5.1. Relevance and Biological Plausibility. There is bothstructural and functional...
  • 22
  • 231
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Development of Long-Range and High-Speed Wireless LAN for the Transmission of Telemedicine from Disaster Areas" pdf

... Journal on Wireless Communications and NetworkingVolume 2008, Article ID 724010, 13 pagesdoi:10.1155/2008/724010 Research Article Development of Long-Range and High-Speed Wireless LAN for the Transmission ... City,Nagano). The wireless networks made up of these wireless LAN units are shown in Figure 5. The wireless LAN in 2.4 GHz band should be operated inline of sight. The area between the main drill site and ... Cordova, P. Boets, and L. Van Biesen, “Analysis and appli-cations of Wi-MAX standard: forecasting the trends”.[13] J. Crouse, M. D’alessandro, and F. Lengerich, “WiMAX and the future of wireless technology,”...
  • 13
  • 318
  • 0
BIOMASS – DETECTION, PRODUCTION AND USAGE pdf

BIOMASS DETECTION, PRODUCTION AND USAGE pdf

... existing and potential biomass usage pathways is critical for charting the way forward at the global scale, and in different regions. Biomass Detection, Production and Usage 16estimation ... tree height estimation, crown size estimation for volume and biomass estimation of different forest Biomass Detection, Production and Usage 24Moorthy, I.; Miller, J.R.; Berni, J.A.J.; Zarco-Tejada, ... Cultivation 321 Jaromír Lachman, Milan Kroutil and Ladislav Kohout Biomass Detection, Production and Usage 30the crop’s ability to intercept radiation and photosynthesize (Ma et al., 1996)....
  • 508
  • 393
  • 0
346 Biomass – Detection, Production and Usage live yeast biomass for the leavening of bread docx

346 Biomass Detection, Production and Usage live yeast biomass for the leavening of bread docx

... glycerol, mixtures of dextrose and xylose, xylose Production of Enriched Biomass by Carotenogenic Yeasts - Application of Whole-Cell Yeast Biomass to Production of Pigments and Other Lipid Compounds ... cells (6 3–7 4%) and the fibrillar part of cell wall ( 2–2 2%), whereas exopolymers bound only 1 2–3 2% of the total sorbed amount. The yeasts with high content of the carotenoid pigments and selenium ... which is used for the biosynthesis of both carotenoids and sterols. The production of ergosterol was very similar to the production of -carotene, even if these metabolites were formed in competitive...
  • 51
  • 394
  • 0
IDENTIFICATION OF A MINIMAL CIS-ELEMENT AND COGNATE TRANS-FACTORS REQUIRED FOR THE REGULATION OF RAC2 GENE EXPRESSION DURING K562 CELL DIFFERENTIATION

IDENTIFICATION OF A MINIMAL CIS-ELEMENT AND COGNATE TRANS-FACTORS REQUIRED FOR THE REGULATION OF RAC2 GENE EXPRESSION DURING K562 CELL DIFFERENTIATION

... upstream or downstream of a gene, within a gene, or thousands of base pairs away from the start site of the gene. Enhancers contain binding sites for transcription factors that communicate with the ... Aurora/AIK family, Aurora -A and Aurora-B, have been identified as the histone H3 kinase (Crosio, Fimia et al. 2002). A balance of protein phosphatase and kinase activities is needed to maintain steady ... in the activation of early response genes such as c-Fos and c-Jun (Clayton, Rose et al. 2000). Protein phosphatase 1 appears to be the histone H3 phosphatase and two kinases of the Aurora/AIK...
  • 144
  • 242
  • 0
design, synthesis, and biological evaluation of new anti-cancer nitrogen-containing combretastatins and novel cysteine protease inhibitors for the treatment of chagas

design, synthesis, and biological evaluation of new anti-cancer nitrogen-containing combretastatins and novel cysteine protease inhibitors for the treatment of chagas

... Evaluation of New Anti-cancer Nitrogen-Containing Combretastatins and Novel Cysteine Protease Inhibitors for the Treatment of Chagas Rogelio Siles Mentor: Kevin G. Pinney, Ph.D. In an effort ... Six: Synthesis, Design and Biochemical Evaluation of Cysteine Protease Inhibitors: Novel Compounds for Chagas Disease Treatment 143 Introduction 143 Background 144 Chemotherapy of Chagas ... Synthesis of Nitrogen-Based Epoxide Derivatives of Combretastatins A-1 and A-4 66 Synthesis of Cold Precursors of Radio-labeled Combretastatins CA-1 and CA-4 70 Synthesis of OXi8007 and...
  • 516
  • 254
  • 0

Xem thêm

Từ khóa: • exploiting properties of graphene and related two dimensional materials for the emergence of a graphene based translational tdiscovery and development of maraviroc and pf 232798 ccr5 antagonists for the treatment of hiv 1 infectiongerd and gastrointestinal cancers from iran an application for the design of early detection of cancer and providing prognostic information to patients in a clinical settingthe majority of past biomass gasifier demonstrations have been for the generation of process heat steam and electricity rdesign production and control operations required for the delivery of nursing on an agency wide basis 1969transformation and somatic cell genetics for the improvement of energy production in microalgaeleal y a flores l l garcía cortés l b cedillo rivera r and torres j 2008 antibody based detection tests for the diagnosis of helicobacter pylori infection in children a meta analysis plos one 3 e3751the discovery that micrornas mirnas are synthesized as hairpincontaining precursors and share many features has stimulated the development of several computational approaches for identifying new mirna genes in various animal speciesresulting in dramatic increases in healthcare costs understanding the processes and metabolic perturbations that contribute to the expansion of adipose depots accompanying obesity is central to the development of appropriate therapeutic strategiesand there is an immediate need for the development of novel and more effective therapeutic modalities against this deadly diseaseguidelines for the administration of enteral and parenteral nutrition in paediatricsguidelines for the use of enteral and parenteral nutritionguidelines for the administration of enteral and parenteral nutrition in pediatricsaspen guidelines for the use of parenteral and enteral nutrition 2009aspen board of directors guidelines for the use of parenteral and enteral nutritionNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Chuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM