transformation and somatic cell genetics for the improvement of energy production in microalgae

Báo cáo y học: "Comparative study between the Hybrid Capture II test and PCR based assay for the detection of human papillomavirus DNA in oral submucous fibrosis and oral squamous cell carcinoma" pdf

Báo cáo y học: "Comparative study between the Hybrid Capture II test and PCR based assay for the detection of human papillomavirus DNA in oral submucous fibrosis and oral squamous cell carcinoma" pdf

Ngày tải lên : 12/08/2014, 01:22
... oncoproteins, which cause deregulation of the cell cycle by inactivating p53 and pRb respectively [9] Integration often disrupts the integrity and expression of the E1 and E2 open reading frames, ... approximately 26% of all OSCC of the head and neck worldwide [7] but the most accurate and consistent study for OSMF and OSCC, in which viral integration and the expression of viral oncogenes (E6 and E7) ... relates to the index of the intensity of HPV infection This ratio of any specimen represents empirically a relative measure of the viral load in it Cut off value (RLU of specimen/ mean RLU of PC)...
  • 10
  • 453
  • 0
The Potential of Biofumigants as Alternatives to Methyl Bromide for the Control of Pest Infestation in Grain and Dry Food Products

The Potential of Biofumigants as Alternatives to Methyl Bromide for the Control of Pest Infestation in Grain and Dry Food Products

Ngày tải lên : 25/10/2013, 05:20
... phosphine is a quick and effective tool for the control of stored-product insect pests In view of the scheduled phaseout of methyl bromide under the Montreal protocol, the role of phosphine in grain ... of all oils tested The main component of one of the oils is pulegone The other is not yet identified and it is called SEM76 (Shaaya and Kostyukovsky, 2006) In our study of the mode of action of ... evaluate the toxicity of allyl ITC in grain, we could show that 20 μL·L−1 air (=20 g m−3 ) and exposure time of day were not effective in killing the insects at the bottom of the column when the fumigant...
  • 20
  • 483
  • 0
Alternative Processing Technologies for the Control of Spoilage Bacteria in Fruit Juices and Beverages

Alternative Processing Technologies for the Control of Spoilage Bacteria in Fruit Juices and Beverages

Ngày tải lên : 25/10/2013, 21:20
... 90% of their energy at a wavelength of 253.7 nanometers Exposure of bacteria to UV results in cross-linking of the thymine dimers of the DNA in the organism, preventing repair of injury and reproduction ... is among the main reasons for contamination in fruit juice Washing and brushing fruit before the juicing step is common in juice processing According to one industry survey, 98% of orchards surveyed ... growing of fruit, harvesting, postharvest handling, washing, and cooling and storage PREVENTIVE MEASURES IN THE ORCHARD Contamination of fruits with feces of animals such as deer,8 seagulls,9 and...
  • 21
  • 691
  • 2
Tài liệu APICE: Common Mediterranean strategy and local practical Actions for the mitigation of Port, Industries and Cities Emissions   pdf

Tài liệu APICE: Common Mediterranean strategy and local practical Actions for the mitigation of Port, Industries and Cities Emissions   pdf

Ngày tải lên : 17/02/2014, 22:20
... meeting of the APICE project will be held in Venice on 24th 26th January 2012 During the meeting a full day will be devoted to the discussion of the results of the intercomparison campaign held in ... prominent forums for discussing the latest scientific developments, applications and implications for policy and other users An important feature of the conference is that it brings together ... concerning the intensive monitoring campaign in each pilot area are available here: Air monitoring campaign in Venice.pdf Air monitoring campaign in Genoa.pdf Air monitoring campaign in Thessaloniki.pdf...
  • 4
  • 452
  • 0
New ESPGHAN guidelines for the diagnosis of Coeliac Disease in Children and Adolescents pptx

New ESPGHAN guidelines for the diagnosis of Coeliac Disease in Children and Adolescents pptx

Ngày tải lên : 22/03/2014, 09:20
... suggestive of CD without increasing the risk of misclassification Preconditions are • • • • high quality serology including EMA taking quantitative antibody levels into account HLA typing full information ... person at genetic risk for CD Explain implication of positive test result(s) and get consent for testning HLA DQ2 / DQ8 (+/- TG2) HLA positive DQ2 and/ or DQ8 Consider retesting in intervals or if symptomatic ... antibody levels there no urgency to perform biopsies compared to symptomatic patients with the same low levels Conclusions The new guidelines will offer the option of omitting biopsies in selected...
  • 33
  • 537
  • 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

Ngày tải lên : 28/03/2014, 15:20
... part  of the lost  wave  energy is  transformed  into  turbulence  energy.   At  the beginning  of the wave  breaking  process,  the turbulence  is  confined into a small portion of the breaking  ... Fig. 1. The coordinate system and method for the evaluation of a wetting and drying boundary.  The procedure  for determining  the cell side  wetted  function  and the cell area  wetted  function  in the numerical  ... of the cell side  wetted function is 1. For other cases, value of the cell side  wetted  function  equals  to  the ratio of the length of the wetted portion over  the total length of the cell side. After getting ...
  • 11
  • 460
  • 0
Financial Accounting: A comprehensive and practical online guide for the basics of financial accounting docx

Financial Accounting: A comprehensive and practical online guide for the basics of financial accounting docx

Ngày tải lên : 29/03/2014, 14:20
... Advances For more information, please visit: www.kesdee.com of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of ... Leases and Off-Balance-Sheet Debt The course explains the fundamentals of lease financing and focuses on various forms of offbalance-sheet financing Further, it differentiates between operating and ... depreciation, valuation of inventories etc.) influences the financial statements and thereby the pre-tax income and the income tax payable When the tax reporting and financial reporting differs, it leads...
  • 6
  • 544
  • 1
Báo cáo hoa học: " Research Article Necessary and Sufficient Conditions for the Existence of Positive Solution for Singular Boundary Value Problems on Time Scales" pot

Báo cáo hoa học: " Research Article Necessary and Sufficient Conditions for the Existence of Positive Solution for Singular Boundary Value Problems on Time Scales" pot

Ngày tải lên : 21/06/2014, 20:20
... condition for the existence of Cld 0, T as well as Cld 0, T positive solutions is given by constructing upper and lower solutions and with the maximum principle The nonlinearity f t, x may be singular ... follows In Section 2, we provide some necessary background In Section 3, the main results of problem 1.1 - 1.2 will be stated and proved In Section 4, the main results of problem 1.1 – 1.3 will be investigated ... neighborhood U of t with y ρ t −y s − y∇ t ρ t − s
  • 14
  • 394
  • 0
Báo cáo hóa học: " Combination of Polymer Technology and Carbon Nanotube Array for the Development of an Effective Drug Delivery System at Cellular Leve" pptx

Báo cáo hóa học: " Combination of Polymer Technology and Carbon Nanotube Array for the Development of an Effective Drug Delivery System at Cellular Leve" pptx

Ngày tải lên : 22/06/2014, 00:20
... tissueelectrode interface in case of in vivo applications In future, enabling bionanotechnology should open new perspectives in the design of the NI, allowing the integration of multisites for specific and ... negligible number of cells (about 10%) are differentiated After 24 h, there is a spread of the number of differentiated cells, being about 85% of the total cells In the second day, the number increased ... sticking in a liquid environment A thin film of alginate containing NGF was thereafter deposited on the CNT array The polymer fills the array for few microns (*5 lm) allowing the CNTs to expose their...
  • 6
  • 485
  • 0
Báo cáo vật lý: "Immobilization of Dithizone onto Chitin Isolated from Prawn Seawater Shells (P. merguensis) and its Preliminary Study for the Adsorption of Cd(II) Ion" pdf

Báo cáo vật lý: "Immobilization of Dithizone onto Chitin Isolated from Prawn Seawater Shells (P. merguensis) and its Preliminary Study for the Adsorption of Cd(II) Ion" pdf

Ngày tải lên : 07/08/2014, 14:20
... on the glucosamine ring and water molecules are reduced due to the binding of the –OH group to –NH groups of dithizone The weak band at 2893.0 cm–1 indicates stretching C-H of olefin and the ... reduce the metal adsorption capacity of the adsorbents The basic structure of chitin consists of glucosamine ring bearing –OH group Since the binding and steric hindrance between –OH group and glucosamine ... glucosamine ring is quite strong, the direct binding of –NH group of dithizone to glucosamine ring by substituting the –OH group is unlikely to happen Therefore, the interaction of dithizone and...
  • 16
  • 416
  • 0
Báo cáo toán học: "Invariant and coinvariant spaces for the algebra of symmetric polynomials in non-commuting variables" pps

Báo cáo toán học: "Invariant and coinvariant spaces for the algebra of symmetric polynomials in non-commuting variables" pps

Ngày tải lên : 08/08/2014, 12:23
... features of S and T Section describes the place-action structure of T and the original motivation for our work Our main results are proven in Sections and We underline that the harder part of our ... S W the ring of W -invariant polynomials for this action To finish parsing (1), recall that SW stands for the coinvariant space, i.e., the W -module W SW := S/ S+ (2) defined as the quotient of ... minimum elements The shape λ(A) of a set partition A = {A1 , A2 , , Ar } is the (integer) partition λ(|A1 |, |A2|, , |Ar |) obtained by sorting the part sizes of A in increasing order, and...
  • 17
  • 364
  • 0
báo cáo khoa học: "Surgical perspectives from a prospective, nonrandomized, multicenter study of breast conserving surgery and adjuvant electronic brachytherapy for the treatment of breast cancer" pps

báo cáo khoa học: "Surgical perspectives from a prospective, nonrandomized, multicenter study of breast conserving surgery and adjuvant electronic brachytherapy for the treatment of breast cancer" pps

Ngày tải lên : 09/08/2014, 01:24
... published guidelines for the screening and selection of patients for Page of 10 APBI [22,23], and these guidelines formed the basis for patient selection in the EBT multicenter study [20] Of the 65 patients ... groups of patients meeting all inclusion criteria and those ineligible for treatment Factors affecting the success of implanting the balloon applicator and administering the prescribed radiation therapy ... breast and skin within an area of less than 2.5 cm of the skin surface As seen in Figure 2, this can readily be accomplished by using modifications of the standard oncoplastics incisions Since the...
  • 10
  • 389
  • 0
báo cáo khoa học: " Social networks, work and network-based resources for the management of long-term conditions: a framework and study protocol for developing self-care support" potx

báo cáo khoa học: " Social networks, work and network-based resources for the management of long-term conditions: a framework and study protocol for developing self-care support" potx

Ngày tải lên : 10/08/2014, 10:23
... and sustaining existing illness-management practices in everyday life These include the formal and informal, visible and invisible work that is involved in the engagement, sense-making, and appraisal ... characterised by asymmetries of power and knowledge and to offer understandings of continuities and discontinuities in behaviours and processes involved in sustaining behaviour change [17] Here ... discussion in the literature of the types of networks that support or undermine self-care and of network properties, as well as a lack of understanding of the processes involved that underpin the development...
  • 7
  • 331
  • 0
báo cáo khoa học: "Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice" pptx

báo cáo khoa học: "Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice" pptx

Ngày tải lên : 11/08/2014, 00:23
... disease in the knockout model [37] or the fibrolysis of ECM content [38] For better understanding we have compared the contribution of either HSC or MSC in the process of reversal of cirrhosis in the ... Less invasions of inflammatory cells in the MSC and MSC-+HGF-CNP treated groups connect with the anti-inflammatory action of MSC Moreover, the direct involvement of MSC in immunomodulation of hepatic ... inflammatory cytokines could reduce the activation of hepatic stellate cells Inhibition of the proliferation of T cells thereby modulating the pro-inflammatory cytokines such as TNF-a and IL1bby MSC...
  • 11
  • 404
  • 0
Báo cáo y học: "Anti-inflammatory effects of antidepressant and atypical antipsychotic medication for the treatment of major depression and comorbid arthritis: a case report" pdf

Báo cáo y học: "Anti-inflammatory effects of antidepressant and atypical antipsychotic medication for the treatment of major depression and comorbid arthritis: a case report" pdf

Ngày tải lên : 11/08/2014, 14:21
... be influenced by the effects of mirtazapine as the patient had been treated continuously with this compound long before and after the clinical improvement This leaves us to the discussion of the ... medication indicates a significant change in symptom presentation with a decline in pain and depressive symptoms while the activity levels increased continuously Moreover, the findings in this case ... antiinflammatory effects In addition, the sleep-inducing properties of quetiapine might have contributed to a symptom relief through the link between sleep improvement and pain relief All together,...
  • 4
  • 387
  • 0
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx

báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx

Ngày tải lên : 11/08/2014, 20:21
... differences in the diameter of the cavity between the two projectiles were found 6.0-10.0 cm behind the point Page of of impact of the projectile on the gelatin block In this area, the gelatin blocks ... within the ruptures of a temporary cavity in the gelatin block revealed a deposition of particles along the entire bullet path for both types of projectiles examined In the case of the soft point ... and reproducible method of systematic examination in the field of terminal ballistics The model permits the infiltration depth of exogenous particles leading to contamination in relation to the...
  • 5
  • 573
  • 0
Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt

Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt

Ngày tải lên : 12/08/2014, 04:21
... were designed and RT-PCR procedures were developed for the specific detection of PVM in various potato samples and for the confirmation of PCR amplicons The efficacy of RT-PCR for indexing seed potato ... CTTCATTTGTTATTCGACTT) and PVM2 (Forward: ATGGGAGATTCAACRAAGAA) were used for amplifying the entire CP gene and the nucleotide sequences of the amplicons (917 bp) were then determined in both directions using the ... farm in the province of Page of Figure Sensitivity of RT-PCR using primer set PVM3/PVM4 for detecting PVM in composite sprout (A) and dormant tuber (B) samples RNA extracted from mixtures of infected...
  • 7
  • 452
  • 0
Báo cáo y học: " RNA silencing and HIV: A hypothesis for the etiology of the severe combined immunodeficiency induced by the virus" pot

Báo cáo y học: " RNA silencing and HIV: A hypothesis for the etiology of the severe combined immunodeficiency induced by the virus" pot

Ngày tải lên : 13/08/2014, 05:21
... in the interleukin15 mRNA, a key cytokine involved in NK cell functioning In addition, until conditions are appropriate in the host cell for intact HIV RNA and protein production, dicing up the ... RNA and mRNAs for the viral proteins Double-stranded RNA initiates RNAi and could allow intrinsic HIV control of when viral RNAs are made In addition, the antisense RNA forms an intrinsic, intramolecular ... the proteins eIF2C2, and helicases Gemin3 and Gemin4 [85,97,98] The miRNA within the ribonucleoprotein complex serves to guide the protein machinery to complementary sites in the human cell messenger...
  • 13
  • 301
  • 0
Báo cáo y học: "A unified framework of immunological and epidemiological dynamics for the spread of viral infections in a simple network-based population" ppt

Báo cáo y học: "A unified framework of immunological and epidemiological dynamics for the spread of viral infections in a simple network-based population" ppt

Ngày tải lên : 13/08/2014, 16:21
... Av (t), in the population was the integral of the mean viral load from the beginning of a given simulation (time 0) until time t, and was used as a proxy for the final size and severity of an outbreak ... to be related to the size of the infecting dose a person initially receives [23] Therefore, we also investigated the impact of varying the infecting doses a person received from their network contacts ... Discussion Variations in the infecting dose As expected, increases to the constant φ resulted in an increase in a person's viral load It bears noting that, increasing the viral load incoming from a person's...
  • 13
  • 334
  • 0
Báo cáo y học: " Mathematical model of blunt injury to the vascular wall via formation of rouleaux and changes in local hemodynamic and rheological factors. Implications for the mechanism of traumatic myocardial infarction" pot

Báo cáo y học: " Mathematical model of blunt injury to the vascular wall via formation of rouleaux and changes in local hemodynamic and rheological factors. Implications for the mechanism of traumatic myocardial infarction" pot

Ngày tải lên : 13/08/2014, 22:22
... [4] Therefore, in accordance with the above, trauma may create transient conditions for the formation of rouleaux or for the interlacing of existing rouleaux that have formed in the flowing blood ... shows these data and indicates that the main source of rouleaux is the erythrocytes themselves The higher the erythrocyte concentration, the more rouleaux remain in the blood despite an increase in ... u2, the particle size a, the quantities and shapes of inclusions, and the physical properties of the phases (see equation 1) (The effects of the shape and multiplicity of particles, and of some...
  • 10
  • 345
  • 0

Xem thêm