0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Cia5d regulates a new fibroblast-like synoviocyte invasion-associated gene expression signature" pptx

Báo cáo y học:

Báo cáo y học: "Cia5d regulates a new fibroblast-like synoviocyte invasion-associated gene expression signature" pptx

... Nakamura K, Tokunaga Y, Hanada S, Kumemura H, Maeyama M, Harada M, Ogata H, YanoH, Kojiro M, Ueno T, Yoshimura A, Sata M: Spreds, inhibitors ofthe Ras/ERK signal transduction, are dysregulated ... GGCCTGTTTGGCACTATGTGALOC309362 Dnmbp 16 Exiqon Universal probe 97 TTGTCTCAGCATGGGTCCTA ACCAGGATTTTAAGGCCACANM_001107408 Gins3 3–4 Exiqon Universal probe 17 GTCGTGGACCTCCACAAAAT GAACCGTCCAATAAAAGTCTGCDown-regulated ... GTGAACTCCTTCCCACTCCA CAGCTGCATTTCTGGAAACANM_017207.1 Trpv2 15 Exiqon Universal probe 6 CTCTTCCCACCTTATCTGAGGA GACCTGAAGGGGCAGATGNM_019357.1 Vil2 13 CCCCAAGACCCAGTGGAATCCTCC a AGGTACCGGGCGATGTTCT...
  • 14
  • 337
  • 0
Báo cáo y học:

Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

... emergencymedical call centre organization reform in Finland.Material and methods A retrospective observational study was conducted inthe EMCC in East and Central Uusimaa, an area ofsouthern Finland ... werecalculated by logistic regression. Probability that was thesame or below 0.01 was accepted as statisticallysignificant.Results A total of 67 610 emergency calls were analyzed, and ofthese, ... Handbooks of the Ministry of Social Affairs and Health Ambulance andemergency care services: A handbook for drawing up an alarmprocedure. Finland Helsinki; 2005, 56.7. Kuisma K, Boyd J, Väyrynen...
  • 5
  • 495
  • 0
Báo cáo y học:

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

... 3-5 days maintains the same efficacy. [25] Anyway, we may have favourable issues by changing the dose of ras-buricase, according to the various clinical states, the type of malignancy and drugs ... University of Catania, Catania, Italy Correspondence to: Mariano Malaguarnera, A. P., Via Messina 829 – 95125 Catania (Italy). Phone ++39 95 7262008; Fax ++39 95 7262011; E-Mail: malaguar@unict.it ... S, Kantarjian H, Irwin D, et al. Efficacy and safety of ras-buricase, a recombinant urate oxidase (Elitek TM), in the man-agement of malignancy–associated hyperuricemia in pediatric and adult...
  • 11
  • 715
  • 0
Báo cáo y học:

Báo cáo y học: "Human depression: a new approach in quantitative psychiatry" pdf

... 10.1186/1744-859X-9-25Cite this article as: Cocchi et al., Human depression: a new approach in quantitative psychiatry Annals of General Psychiatry 2010, 9:25Cocchi et al. Annals of General Psychiatry 2010, 9:25http://www.annals-general-psychiatry.com/content/9/1/25Open ... intracellular event (for example, activation of adenylate cyclase).Cocchi et al. Annals of General Psychiatry 2010, 9:25http://www.annals-general-psychiatry.com/content/9/1/25Page 5 of 6objective ... Grant B, Hoffman PL, Tabakoff B: Platelet adenylyl cyclase activity as a trait marker of alcohol dependence. Alcohol Clin Exp Res 2000, 24:810-821.34. Hines LM, Tabakoff B: Platelet adenylyl...
  • 6
  • 435
  • 0
Báo cáo y học:

Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx

... blockade for 14 days in a patient with rheumatoidarthritis (haematoxylin–eosin staining; original magnification ×400).After active treatment there was a marked reduction in synovialcellularity, ... sclerosis, transplant rejection and inflammatorybowel disease [4]. Analysis of synovial tissue, synovial fluidand peripheral blood from patients with rheumatoid arthritis(RA) revealed abundant expression ... (pro)inflammatory mediators suchas cytokines and matrix metalloproteinases [3]. Increased expression of inflammatory chemokines has been found inmany inflammatory disorders, including hepatic disease,multiple...
  • 5
  • 460
  • 0
Báo cáo y học:

Báo cáo y học: " Histone deacetylases — a new target for suppression of cartilage degradation" pdf

... lysinesidechains undergo acetylation, through the action of histoneacetyltransferases, by way of acetyl coenzyme A, a stepwhich is associated with transcriptional activation. Thesemodifications ... metalloproteinases.Available online http://arthritis-research.com/contents/7/4/155AbstractIncreased expression of metalloproteinases is a fundamental aspectof arthritis pathology and its control is a ... by cytokines, intracellular signaling, andtranscription factor action, but recent work by Young andcolleagues [1] indicates that there is significantly more to thisprocess than has been generally...
  • 2
  • 397
  • 0
Báo cáo y học:

Báo cáo y học: "Clinical bioinformatics: a new emerging science" pot

... heterogeneous data sets [8]. This particularstudy tried to match disease complexity of patient infor-mation, clinical data, standard laboratory evaluations,brain imaging data and genetic data obtained ... health-care, enable researchers to search online biologicaldatabases and use bioinformatics in medical practice,select appropriate software to analyze the microarraydata for medical decision-making, ... simultaneousevaluation of clinical and basic research could improvemedical care, care provision data, and data exploitationmethods in d isease therapy and algorithms for the ana-lysis of such heterogeneous...
  • 3
  • 264
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Core strength: A new model for injury prediction and prevention" pptx

... one-year period.Statistical AnalysesPart One. Functional Movement ScreenData was coded using Stata 8.0. For exploratory data anal-ysis we used bivariate methods. The primary hypothesiswas assessed ... 3Lunda and Associates, 1636 North Swan, Tucson, Arizona, USAEmail: WF Peate* - peate@email.arizona.edu; Gerry Bates - Gerry.Bates@tucsonaz.gov; Karen Lunda - k.lunda@worldnet.att.net; Smitha ... Smitha Francis - francis@email.arizona.edu; Kristen Bellamy - bellamy@email.arizona.edu* Corresponding author AbstractObjective: Many work in injury prone awkward positions that require adequate...
  • 9
  • 468
  • 0
Báo cáo y học:

Báo cáo y học: " Mithramycin downregulates proinflammatory cytokine-induced matrix metalloproteinase gene expression in articular chondrocytes" ppsx

... from the American Type CultureCollection (ATCC, Manassas, VA) and treated as describedfor primary chondrocytes.Northern hybridization analysisTotal cellular RNA was extracted by the guanidinium ... factor. J BiolChem 2000, 275:1708-1714.29. Kardassis D, Papakosta P, Pardali K, Moustakas A: c-Jun transac-tivates the promoter of the human p21(WAF1/Cip1) gene byacting as a superactivator ... N-terminal kinase.Arthritis Research & Therapy Vol 7 No 4 Liacini et al.R778Materials and methodsPrimary cultures of human and bovine chondrocytes, SW1353 cells and treatmentsHuman cartilage...
  • 7
  • 294
  • 0
Báo cáo y học:

Báo cáo y học: " DNA methylation patterns associate with genetic and gene expression variation in HapMap cell lines" ppt

... Repositories.Methylation d ata were obtained using the IlluminaHumanMethylation27 DNA Analysis BeadChip assay.Methylation estimates were assayed using two technicalreplicates per individual and methylation levels ... stochasticand environmental factors are also likely to play animportant role [2,14]. Recent work indicates that geneticvariation may have a substantial impact on local methy-lation patterns ... 12:R10http://genomebiology.com/2011/12/1/R10Page 4 of 13RESEARC H Open AccessDNA methylation patterns associate with geneticand gene expression variation in HapMap cell linesJordana T Bell1,3*, Athma A Pai1,...
  • 13
  • 396
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ