Báo cáo y học: "nhibition of established collagen-induced arthritis with a tumour α necrosis factor-α inhibitor expressed from a self-contained doxycycline regulated plasmid" pptx
Báo cáo y học: "nhibition of established collagen-induced arthritis with a tumour α necrosis factor-α inhibitor expressed from a self-contained doxycycline regulated plasmid" pptx
... arthritis with a tumour necrosis factor- α inhibitor expressed from a self-contained doxycycline regulated plasmidDavid J Gould, Carly Bright and Yuti ChernajovskyBone & Joint Research Unit, Barts ... contrast, anti-TNF -α therapy causes a reversal of chronic symptoms in a large proportion of RA patients, which clearly highlights a differential outcome from anti-TNF -α therapy in CIA andhuman disease.The ... up to 1 year [10]. PlasmidDNA also has the advantage of being very stable and botheasy and cheap to produce in large quantities.Ideally, gene therapy for a chronic disease such as RA willpermit...
- 11
- 464
- 0
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
... Paducah, Paducah, KY, USA 5. Statistician at the Pain Management Center of Paducah, Paducah, KY, USA Corresponding author: Laxmaiah Manchikanti, MD, 2831 Lone Oak Road, Paducah, Kentucky ... Vidyasagar Pampati5 1. Medical Director of the Pain Management Center of Paducah, Paducah, KY and Associate Clinical Professor, Anest-hesiology and Perioperative Medicine, University of ... 539-45. 15. Schwarzer AC, Wang SC, Bogduk N, et al. Prevalence and clinical features of lumbar zygapophysial joint pain: A study in an Australian population with chronic low back pain. Ann Rheum...
- 12
- 669
- 0
Báo cáo y học: "Treatment of proximal femur infections with antibiotic-loaded cement spacers"
... two-parted mould of polyoxymethylene [1]. The bone cement used in all cases was Refobacin-Palacos ® (Fa. Merck, Darmstadt, Gemany), each spacer was loaded with 4 g vancomy-cin (Fa. cell pharen ... [52-77] years. After infection eradication, a prosthesis has been reimplanted in 8 cases. One pa-tient passed away due to an unclear cause between stages, another patient (bilateral spacer implantation) ... Akpinar S, Tandogan RN, Alparslan M. Two-stage treatment of chronic staphylocccal orthopaedic im-plant-related infections using vancomycin impregnated PMMA spacer and rifampin containing antibiotic...
- 7
- 579
- 0
Báo cáo y học: "Management of Critically Ill Patients with Severe Acute Respiratory Syndrome (SARS)"
... mortality in all 60 clinically-defined SARS patients, mean age 30.5 years. With 40% treated with CPAP and none requiring mechanical ventilation. Subsequently, very low mortality was again recorded ... pathology of severe acute respiratory syndrome (SARS): a study of 8 autopsy cases from Singapore. Hum Pathol, 2003. 34:743-8. 51. Wang H.J., et al. Fatal aspergillosis in a patient with SARS who has ... overall CFR is approximately 15% [54]. Variability may be due to different host and viral factors as well as treatment strategies. CFR may also be significantly affected by the duration of follow-up...
- 10
- 575
- 0
Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt
... ERK1/2.Recent observations indicate that activation of Raf byPMA may trigger the same signaling pathway as oncogenicRaf, or Raf activation by Ras in combination with tyrosinephosphorylation [30]. ... of DNA synthesis and cellproliferation of human mammary myoepithelial-like cells byhepatocyte growth factor/scatter factor depends on heparansulfate proteoglycans and sustained phosphorylation ... Dhake-phalkar ,A. ,Weber,M.J.,Ravichandran,K.S.&Gonias,S.L.(2000) Urokinase-type plasminogen activator stimulates the Ras/Extracellular signal -regulated kinase (ERK) signaling pathwayand...
- 10
- 703
- 0
Báo cáo Y học:Association of the thyrotropin receptor with calnexin, calreticulin and BiP Effects on the maturation of the receptor docx
... wasobtained from NEN Life Science Products (Paris, France).Calnexin rabbit polyclonal antibody (SPA-860), calreticulinrabbit polyclonal antibody (SPA-600), BiP rabbit polyclo-nal antibody (SPA ... for 2 min at 10 000 g.Thesupernatant was immunoprecipitated with mAb A1 0. Samples wereanalyzed by SDS/PAGE after reduction: (A) SDS/PAGE analysis; (B)quantification using a Phosphorimager, s, ... 826), and KDEL mouse monoclonalantibody (SPA-827) were obtained from Stressgen (Victoria,Canada). Monoclonal anti-mouse immunoglobulin peroxi-dase conjugate was obtained from Amersham PharmaciaBiotech...
- 8
- 443
- 0
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... SequenceGSTM1-forA 5¢-AATTCCATGCCTATGATACTGGGAT-3¢GSTM1-forB 5¢- CCATGCCTATGATACTGGGAT-3¢GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢GSTM2-forB ... 4AS-6 ACAAAGCATGATGAGCTGCA CDS 326–345 – 8AS-7 GAGTAGAGCTTCATCTTCTC CDS 397–426 – 1AS-8ACTGGTCAAGAATGTCATAA CDS 480–499 – 7AS-9 CAGGTTTGGGAAGGCGTCCA CDS 524–543 524–543 0AS-10 CAGGCCCTCAAACCGAGCCA ... Netherlands). A horseradish peroxidase-conjugated antirabbit IgG antibodyand an enhanced chemiluminescence assay were purchased from Amersham Pharmacia Biotech. All other chemicalswere of analytical...
- 10
- 432
- 0
Báo cáo y học: "Effect of allergen-specific immunotherapy with purified Alt a1 on AMP responsiveness, exhaled nitric oxide and exhaled breath condensate pH: a randomized double blind study" ppsx
... placebo-controlled study of Alternaria alternata immunotherapy: Clinical efficacy and safety. PediatrAllergy Immunol 2008, 19:67-75.20. Asturias JA, Ibarrola I, Ferrer A, Andreu C, Lopez-Pascual ... (cat and dog), pollens (mixed grass,olive, Parietaria judaica, Artemisia, Platanus orientalis,Cupresus arizonica and Salsola kali), and moulds ( Alter-naria alternata, Aspergillus fumigatus, ... immunotherapy with a standardized Alternaria extract. JAllergy Clin Imunol 1990, 85:460-472.19. Tabar AI, Lizaso MT, Garcia BE, Gomez B, Echechipia S, Aldunate MT,Madariaga B, Martinez A: Double-blind,...
- 11
- 545
- 0
Báo cáo y học: "Outcome of crisis intervention for borderline personality disorder and post traumatic stress disorder: a model for modification of the mechanism of disorder in complex post traumatic syndromes" ppsx
... Community Care, Bellingham, MA, USAFull list of author information is available at the end of the articleLaddis Annals of General Psychiatry 2010, 9:19http://www.annals-general-psychiatry.com/content/9/1/19Page ... Herman JL: Trauma and Recovery: The Aftermath of Violence From Domestic Abuse to Political Terror New York, USA: Basic Books; 1997. 8. Freyd JJ: Betrayal trauma: traumatic amnesia as an adaptive ... showthat lessons from therapy's laboratories of intimacy, suchas reworking old betrayals, reframing beliefs and analysis of the transference, do not generalize sufficiently to makeintimacy...
- 12
- 477
- 0
Báo cáo y học: "Investigation of infectious agents associated with arthritis by reverse transcription PCR of bacterial rRNA" ppsx
... 154CGCACGGGTGAGTAAGGTA GCTTAACACAAGTTGACTAG Campylobacter jejuni 63°C/30 secs 2.5 70CGCACGGGTGAGTAAGGTA GTCTTACATAAGTTAGATA Campylobacter concisus 55°C/30 secs 2.0 70CGCACGGGTGAGTAAGGTA ATACCTCATACTCCTATTTAAC ... (bp)AGTAGTTTACTACTTTGCCG ACTGCTGCCTCCCGTAGGAG Universal (R1 and R2) 58°C/60 secs 1.5 350CATAACGTCGCAAGACCAAA GTGCAATATTCCCCACTGCT E. coli 58°C/45 secs 1.5 187TTGGGAATAACGGTTGGAAA TGTCTCAGTCCCAGTGTTGG ... bacteria.Nevertheless, all of the studies have emphasized that bac-terial nucleic acids can be detected in many forms of inflammatory arthropathy (RA, inflammatory osteoarthritis,crystal arthropathy...
- 8
- 310
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ