Báo cáo khoa học: "Increased expression of neuronal nitric oxide synthase in astrocytes and macrophages in the spinal cord of Lewis rats with autoimmune encephalomyelitis" pps
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... compilation ª 2010 FEBS 4851 Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Yã) ... Auling G (1998) Clon-ing and sequencing of the nrdF gene of Corynebacterium ammoniagenes ATCC 6872 encoding the functionalmetallo-cofactor of the manganese -ribonucleotide reductase (Mn-RRase). ... chemistry involv-ing an array of diverse metallocofactors. The nucleotide reduction gene (nrdF) encoding the metallocofactor containing small subunit (R2F) of the Corynebacterium ammoniagenes ribonucleotide...
- 14
- 872
- 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
... TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan probe 18S TGGACCGGCGCAAGACGGACABFig. ... Journal compilation ê 2007 FEBS 839 Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism Lisa ... rev,reverse.SequenceACMSD cloning: primer1fw CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time PCR: primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw...
- 14
- 601
- 0
Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot
... compilation ê 2011 FEBS Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis Yasuhiro ... reactiveoxygen species and apoptosis in rat primary hepatocytes. Apoptosis wasaccompanied by increased expression of BimEL, following activation of extracellular signal-regulated kinase. The aim of this study ... knockdown of c-Fos orc-Jun attenuated BimEL transactivation and apoptosis, supporting the hypothesis that c-Fos and c-Jun actcoordinately to increase the expression of BimEL. Increased c-Fos levels...
- 9
- 556
- 0
Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt
... 2 74 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma Dorina ... 12917–12922. 24 Adams JC (20 04) Functions of the conserved thrombo-spondin carboxy-terminal cassette in cell extracellularmatrix interactions and signaling. Int J Biochem Cell Biol 36, 1102–11 14. 25 Dinser ... mimicking the RCC phenotype. Furtheranalysis revealed a profound decrease in transient receptor potential canon-ical ion channel 4 (TRPC4) Ca2+ channel expression in RCC cells. TRPC4silencing in...
- 13
- 609
- 0
Báo cáo khoa học: 14-3-3 Proteins regulate glycogen synthase 3b phosphorylation and inhibit cardiomyocyte hypertrophy doc
... 14-3-3 Proteins regulate glycogen synthase 3b phosphorylation and inhibit cardiomyocyte hypertrophy Wenqiang Liao, Shuyi Wang, Chide Han and Youyi ZhangInstitute of ... protein kinase B, PKB) at Ser473 and glycogen synthase 3b (GSK3b) at Ser9, but not extracellular signal-regulated kinase 1 ⁄ 2(ERK1 ⁄ 2). AdR18-induced PKB and GSK3b phosphorylation was com-pletely ... 3).PKB and GSK3b phosphorylation are inducedby R18 and blocked by PI3K inhibitor Glycogen synthase kinase-3 beta (GSK3b), a down-stream signaling molecule of the PI3K ⁄ PKB pathway, and ERK1...
- 10
- 290
- 0
Báo cáo khoa học: Increased sensitivity of glycogen synthesis to phosphorylase-a and impaired expression of the glycogen-targeting protein R6 in hepatocytes from insulin-resistant Zucker fa ⁄ fa rats pptx
... 1999 Increased sensitivity of glycogen synthesis to phosphorylase-a and impaired expression of the glycogen- targeting protein R6 in hepatocytes from insulin-resistant Zucker fa ⁄ fa rats Catherine ... curves.Higher sensitivity of glycogen synthesis to phosphorylase-a in fa ⁄ fa hepatocytes To test whether impaired glycogen synthesis in hepatocytes from fa ⁄ fa rats can be explained by analtered sensitivity ... coupling between phosphorylase-a and glycogen synthesis in hepatocytes from fa fa rats by modulating the concentration of phosphorylase-a. Treatment of hepatocytes from fa ⁄ fa rats and Fa ⁄ ? controls...
- 11
- 360
- 0
Báo cáo khoa học nông nghiệp " Developing GAP systems for dragon fruit producers and exporters in Binh Thuan and Tien Giang provinces " pdf
... GAP Workshop in Binh Thuan (21-22/7/2008) 1 Developing GAP systems for dragon fruit producers and exporters in Binh Thuan and Tien Giang provinces. Nguyen Van Hoa ... Developing GAP systems for dragon fruit producers and exporters in Binh Thuan and Tien Giang provinces, which was aimed at developing quality systems for export market access for dragon fruit has ... Vietnamese personnel. Leading dragon fruit farmers and packers in the Binh Thuan province and packers wishing to develop GAP production and packing units in Tien Giang and Long An based on the...
- 10
- 598
- 0
Báo cáo khoa học: "Increased expression of osteopontin in the spinal cords of Lewis rats with experimental autoimmune neuritis" doc
... àm. Osteopontin in rat spinal cord with EAN 293nerves and spinal roots. These two molecules may beinvolved in cell migration into the spinal cord in the earlystages of EAN. Further study of the ... neurons in the spinal cord express OPN and CD44 in EANImmunohistochemistry showed expression of OPN in some cells in the spinal cord parenchyma and in the subarachnoid space in rats with EAN. In the ... or astrocytes [7,11]. In the present study, we examined the expression of OPN in the spinal cords of rats with EAN. We found that someinflammatory cells infiltrated the spinal nerve roots, andsubarachnoid...
- 5
- 334
- 0
Báo cáo khoa học: "F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters" pdf
... al.:18F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters. Radiation Oncology ... volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parametersChia-Hung Kao1,3, Te-Chun Hsieh1,5, Chun-Yen Yu2,5, Kuo-Yang ... Cidda C,D’Avenia P, Fattori S, Montini GC, Valentini G, Proietti A, Algranati C: Radiotherapy planning: PET/CT scanner performances in the definition of gross tumour volume and clinical target volume. ...
- 8
- 368
- 0
Báo cáo khoa hoc:"A further look at quantitative trait loci affecting growth and fatness in a cross between Meishan and Large White pig populations" potx
... in a cross between Meishan and Large White pig populationsRaquel QUINTANILLA a ∗,DenisMILA Nb,Jean-Pierre BIDANEL a a Station de génétique quantitative et appliquée,Institut national ... withfattening batch as a fixed effect are presented;coviis a covariate that varied according to the trait analysed: age at meas-urement for weights and ABT during the fattening period, and ... 23 April 2001; accepted 15 October 2001)Abstract – A detailed quantitative trait locus (QTL) analysis of growth and fatness data from a three generation experimental cross between Large White...
- 18
- 258
- 0
báo cáo khoa học: " Increased IL-10 mRNA expression in tumorassociated macrophage correlated with late stage of lung cancer" pps
... IL-10, cathepsin B and CD68 in macrophage. A-B, High IL-10 expression in macrophage, A, IL-10 staining in macrophage (strong positivity); B, CD68 staining. C-D, Cathepsin B expression in macrophage; ... IL-10, cathepsin B and cathepsin S (Figure 2B).The mRNA expression levels of IL-10, cathepsin B andcathepsin S in TAMsThe mRNA expression levels of IL-10, cathepsin B andcathepsin S in TAMs were ... the IL-10 mRNA expression level below the median (30.5) in 3 early stage NSCLC. Expression of cathepsin B in macrophage wasobserved in 5 of 6 cases. Among macrophages expres-sing cathepsin B,...
- 9
- 265
- 0
báo cáo khoa học: " Small interference RNA targeting tissue factor inhibits human lung adenocarcinoma growth in vitro and in vivo" ppsx
... this article as: Xu et al.: Small interference RNA targeting tissue factor inhibits human lung adenocarcinoma growth in vitro and in vivo.Journal of Experimental & Clinical Cancer Research 2011 ... RESEARC H Open Access Small interference RNA targeting tissue factor inhibits human lung adenocarcinoma growth in vitro and in vivoChengcheng Xu1, Qi Gui2, Wenshu Chen1, Leiming Wu1, Wei Sun1, ... Huang JW, Xia GW, Ding Q, Liu KD,Zhu HG: Small interference RNA targeting Kruppel-like factor 8 inhibits the renal carcinoma 786-0 cells growth in vitro and in vivo. J Cancer ResClin Oncol 2010,...
- 11
- 202
- 0
Báo cáo khoa học: "Individually Coded Telemetry: a Tool for Studying Heart Rate and Behaviour in Reindeer Calves" ppt
... and reliable tool for measuring heart rate in reindeer, also in naturalconditions. heart rate; measuring technique; method; individual coding; reindeer; behaviour; circadian.Acta vet. scand. 2002, ... food intake in reindeer (Rangifertarandus tarandus). Acta Physiol. Scand. 2000,170, 145-151.Moen AN: Seasonal changes in heart rates, activity,metabolism, and forage intake of white-taileddeer. ... running under human harassmentEating Animal inside the feeding area ingesting feed or water from the grip or chewing and masticating feed close to the feeding areaRuminating Ruminating lying;...
- 10
- 239
- 0
Báo cáo y học: " Arginase strongly impairs neuronal nitric oxide-mediated airway smooth muscle relaxation in allergic asthma" doc
... frequencies, indi-cating that increased arginase activity strongly restrictsiNANC nerve-mediated airway smooth muscle relaxation. The increased relaxation after arginase inhibition wascompletely reversed ... reversed by L-NNA, demonstrating that argin-ase activity attenuates iNANC nerve-mediated airway smooth muscle relaxation by limiting NO production.Since arginase activity in guinea pig airway preparations ... air-ways is increased activity of arginase, which hydrolyzes L-arginine into L-ornithine and urea [10]. Arginase isexpressed in the airways [12] and has shown to be func-tionally involved in...
- 7
- 141
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ