14-3-3 Proteins regulate glycogen synthase 3b phosphorylation and inhibit cardiomyocyte hypertrophy Wenqiang Liao, Shuyi Wang, Chide Han and Youyi Zhang Institute of Vascular Medicine, Peking University Third Hospital and Key Laboratory of Molecular Cardiovascular Science, Ministry of Education, Beijing, PR China 14-3-3 Proteins were first discovered in 1967 as acidic proteins found abundantly in the brain. 14-3-3 Pro- teins comprise a family of highly conserved proteins having a molecular mass of  30 kDa and an isoelec- tric point of around 5 [1]. The proteins of this family are distributed ubiquitously and have been found in all eukaryotic organisms, ranging from yeast to mammals. Many organisms contain multiple isoforms: at least seven isoforms (b, c, e, f, g, h ⁄ s and r) exist in mam- mals and two to 12 isoforms in yeast, fungi, and plants. In all organisms, 14-3-3 proteins form homo- or heterodimeric structures. 14-3-3 Proteins have been shown to bind with over 200 cellular proteins. It is possible that these interactions, like many of those shown previously, occur through the conserved amphipathic groove of 14-3-3 [1–3]. 14-3-3 Proteins specifically recognize phosphoserine ⁄ threonine-contain- ing sequence motifs on target proteins, such as RSXpSXP, RXSX (S ⁄ T) XP or RX (Y ⁄ F) XpSXP. In addition, they can bind to unphosphorylated motifs: GHSL and WLDLE [4–6]. 14-3-3 Proteins have been shown to interact with an array of partners, ranging from enzymes to structural proteins. Often, these proteins are important in vital cellular processes including cell cycle control and apop- tosis. Through its interaction, 14-3-3 either regulate the catalytic activity of its bound enzymes, determine the subcellular localization of target proteins, or both Keywords 14-3-3 proteins; cardiomyocyte; hypertrophy; NFAT; PKB ⁄ GSK3b Correspondence Y. Zhang, Institute of Vascular Medicine, Peking University Third Hospital and Key Laboratory of Molecular Cardiovascular Science, Ministry of Education, Beijing 100083, PR China Fax: +86 10 82802306 E-mail: zhangyy@bjmu.edu.cn (Received 28 September 2004, revised 28 January 2005, accepted 14 February 2005) doi:10.1111/j.1742-4658.2005.04614.x 14-3-3 Proteins are dimeric phophoserine-binding molecules that participate in important cellular processes such as cell proliferation, cell-cycle control and the stress response. In this work, we report that several isoforms of 14-3-3s are expressed in neonatal rat cardiomyocytes. To understand their function, we utilized a general 14-3-3 peptide inhibitor, R18, to disrupt 14-3-3 functions in cardiomyocytes. Cardiomyocytes infected with adeno- virus-expressing YFP-R18 (AdR18) exhibited markedly increased protein synthesis and atrial natriuretic peptide production and potentiated the responses to norepinephrine stimulation. This response was blocked by the pretreatment with LY294002, a phosphoinositide 3-kinase (PI3K) inhibitor. Consistent with a role of PI3K in the R18 effect, R18 induced phospho- rylation of a protein cloned from the vakt oncogene of retrovirus AKT8 (Akt – also called protein kinase B, PKB) at Ser473 and glycogen synthase 3b (GSK3b) at Ser9, but not extracellular signal-regulated kinase 1 ⁄ 2 (ERK1 ⁄ 2). AdR18-induced PKB and GSK3b phosphorylation was com- pletely blocked by LY294002. In addition, a member of the nuclear factor of activated T cells (NFAT) family, NFAT3, was converted into faster mobility forms and translocated into the nucleus upon the treatment of AdR18. These results suggest that 14-3-3s inhibits cardiomyocytes hyper- trophy through regulation of the PI3K ⁄ PKB ⁄ GSK3b and NFAT pathway. Abbreviations a 1 -AR, a 1 -adrenergic receptor; AdR18, adenovirus expressing R18 peptide; ANP, atrial natriuretic peptide; PI3K, phosphoinositide 3-kinase; GSK3b, glycogen synthase 3b; ERK1 ⁄ 2, extracellular signal-regulated kinase 1 ⁄ 2; MOI, multiplicity of infection; NE, norepinephrine; NFAT, nuclear factor of activated T cells; LY, LY294002; PD, PD98059; TDT, terminal deoxynucleotidyl transferase. FEBS Journal 272 (2005) 1845–1854 ª 2005 FEBS 1845 [1,7]. For example, 14-3-3 inhibits ASK1 (apoptosis signal regulating kinase-1) activity by binding to speci- fic residues surrounding Ser967 [8,9]. This interaction also controls the subcellular distribution of ASK1 [10,11]. The binding of 14-3-3 with PI3K, PKC and Raf can either inhibit or enhance the activities of these enzymes [12,13]. 14-3-3 Proteins associate with cdc25c, FKHRL1, HDAC5 ⁄ 7, NFATc, p27 and PKUa, pre- venting their entry into the nucleus [14,15]. 14-3-3 Pro- teins can also modulate protein–protein interactions. For example, 14-3-3 interacts with the apoptosis- promoting protein BAD, preventing BAD from binding to and inhibiting the antiapoptotic function of Bcl-XL [16,17]. Although many 14-3-3 binding partners have been identified, the physiological functions of 14-3-3 remain elusive in many biological systems. This is especially true in the cardiovascular system. One method to determine the importance of 14-3-3 is to use ligand binding-defective 14-3-3 mutants. Examples of these include dominant-negative forms of 14–3-3f and g with the point mutation K49E and the double muta- tion R56A and R60A [8,18]. It is hypothesized that these mutants produce a dominant negative effect by dimerizing with endogenous 14-3-3 monomers, thereby inhibiting the function of these proteins. However, this inhibition is partial and only disrupts a certain iso- form-mediated processes. Additionally, there are tech- nical limitations related to the use of stable cell lines, which place restrictions on its applicability to many 14-3-3-mediated processes. R18 is a 20-mer peptide that was isolated from a phage display screen [19]. With the core motif WLDLE, it was found to globally inhibit 14-3-3–lig- and interactions in a specific and isoform-independent manner [4,20,21]. In this study, we utilized the adeno- virus-expressing YFP-R18 (AdR18) and found that 14-3-3 can inhibit cardiomyocyte hypertrophy and negatively modulate a 1 -adrenergic receptor (a 1 -AR)- mediated hypertrophy. The phosphoinositide 3-kinase (PI3K) ⁄ protein kinase B (PKB) ⁄ glycogen synthase 3b (GSK3b) and nuclear factor of activated T cells (NFAT) pathway most likely contributes to this pro- cess. Results Different isoforms of 14-3-3 proteins are expressed in cardiomyocytes To determine which isoforms of 14-3-3 exist in cardio- myocytes, northern blot analysis was performed using specific probes for the b, c, e, f and h ⁄ s isoforms of 14-3-3. Figure 1A shows that the mRNAs for the b, c, e and f isoforms were detected in isolated cardiomyo- cytes, but no signal of h ⁄ s isoform was observed (data not shown). Furthermore, western blot analysis using antibodies specific for 14-3-3b, c, e and f confirms the expression of these isoforms in cardiomyocytes (Fig. 1A). In adult rats treated with osmotic mini-pumps for continuous norepinephrine (NE) infusion, the expres- sion of 14-3-3f protein in the heart tissue was increased one day after the NE infusion (data not shown). To identify whether the expression of 14-3-3 in isolated cardiomyocytes could be affected by activa- tion of the a 1 -adrenergic receptor (a 1 -AR), cells were treated with 10 lm NE in the presence of 10 lm pro- pranolol for indicated times. Through western blot analysis, we did not find any difference in the expres- sion of 14–3-3f, b, c and e (Fig. 1B). R18 significantly potentiates NE-induced protein synthesis To investigate the role of 14-3-3 in a 1 -AR induced hypertrophy of cardiomyocytes, adenovirus expressing R18 peptide (AdR18), a specific and isoform-independ- 0 1 3 6 12 24 48 time (h) 14-3-3β ζ ε γ 14-3-3 14-3-3 14-3-3 B 14-3-3 mRNA 14-3-3 protein 18sRNA A βγεζ Fig. 1. (A) Different isoforms of 14-3-3 s were expressed in cardio- myocytes. 14-3-3f, e, c and b isoforms expressed in isolated neo- natal cardiomyocytes. Cardiomyocytes cultured in 10 cm plates were serum-free for 24 h, then total RNA was extracted for northern blot analysis. The whole cell lysate was harvested for western blot analysis. The results were representative of four inde- pendent experiments. No signal was detected for the 14-3-3h ⁄ s isoform. (B) No effects of the treatment of NE on the expression of each 14-3-3 isoform. Cardiomyocytes were deprived of serum for 24 h, and incubated with propranolol (10 l M) for 30 min, then stimulated with NE (10 l M) for the times indicated before lysis and analysis by western blotting. The experiment was repeated three times with the same result. 14-3-3 Controls cardiomyocyte hypertrophy through GSK3b W. Liao et al. 1846 FEBS Journal 272 (2005) 1845–1854 ª 2005 FEBS ent inhibitory peptide of 14-3-3, was used. A [ 3 H]leu- cine incorporation assay was performed to measure protein synthesis; an important parameter of cardio- myocyte hypertrophy. Incorporation of [ 3 H]leucine into cardiomyocytes was increased either by treatment with NE (expressed as the fold of control, compared with the control, the NE treated group 1.56 ± 0.31, P < 0.05, n ¼ 5) or by infection with AdR18 (the AdR18 group 1.51 ± 0.23 vs. the Ad group 1.14 ± 0.11, P < 0.05, n ¼ 5) (Fig. 2A). Infection of AdR18 in cardiomyocytes significantly potentiated the NE-induced hypertrophy (Fig. 2B). Compared with the Ad control group, the protein syn- thesis of the Ad + NE treatment group (expressed as the fold of Ad control, 1.51 ± 0.31, P < 0.05, n ¼ 4) increased about 50%, and the AdR18-infected group (1.45 ± 0.26, n ¼ 4) increased about 45%. However, for the AdR18 + NE treatment group (2.41 ± 0.38, n ¼ 4), the protein synthesis increased about 150%, which is much more than the total increment induced by the NE or R18 treatment. These results indicate that R18 potentiated NE-induced protein synthesis in cardiomyocytes. PI3K is critical for R18-induced protein synthesis We next examined which signaling molecule was responsible for the effect of 14-3-3 on protein synthesis and on NE-induced protein synthesis in cardiomyo- cytes. For these experiments, the extracellular signal- regulated kinase 1⁄ 2 (ERK1 ⁄ 2) inhibitor, PD98059 (PD), and the PI3K inhibitor, LY294002 (LY), were used. Figure 2C,D shows that the R18-induced protein synthesis was blocked significantly by LY (10 lm; expressed as fold of control, the AdR18 + LY group vs. the AdR18 group, P < 0.05, n ¼ 3), whereas the NE-induced protein synthesis was blocked by PD (10 lm; the NE + PD group vs. the NE group, P < 0.01, n ¼ 3). The treatment with PD decreased the protein synthesis of the AdR18 + NE group [the AdR18 + NE + PD group 1.31 ± 0.09 (n ¼ 3) vs. the AdR18 + NE group 2.56 ± 0.47 (n ¼ 5), P < 0.05] to the level of the AdR18 treatment alone (the AdR18 group 1.38 ± 0.23, n ¼ 5) (Fig. 2E). Further- more, the protein synthesis was markedly reduced by the LY treatment (the AdR18 + NE + LY group 0.62 ± 0.07 vs. the AdR18 + NE group, n ¼ 3, P < 0.01). R18 induces ANP expression in cardiomyocytes in a PI3K-dependent manner One of the characteristic phenotypic changes of cardio- myocyte hypertrophy is the enhanced expression of the embryonic gene atrial natriuretic peptide (ANP). A detectable level of ANP (40.3 ± 3.2 ng mL )1 , n ¼ 3) 0 1 2 CON NE Ad AdR18 protein synthesis fold of control * * A 0 1 2 3 Ad Ad +NE AdR18 AdR18+NE protein synthesis fold of control * * B 0 1 2 Ad AdR18 AdR18+LY AdR18+PD protein synthesis fold of control * C 0 1 2 CON NE NE+PD NE+LY protein synthesis fold of control ** D E 0 1 2 3 Ad AdR18 AdR18 +NE AdR18 +NE +LY AdR18 +NE +PD protein synthesis fold of control ** * Fig. 2. R18 induced protein synthesis and potentiated the NE-induced protein synthesis in cardiomyocytes in a PI3K dependent manner. Car- diomyocytes cultured in 24-well plates were infected with or without AdR18 or Ad at a MOI of 10. After starvation for 24 h and treatment with propranolol (10 l M) as well as a different inhibitor for 30 min, cells were stimulated with NE (10 lM) for 48 h and 1 lCiÆmL )1 [ 3 H]Leu was added 6 h before analysis by [ 3 H]Leu incorporation assay. (A and B) R18 induced the protein synthesis (n ¼ 5) and also potentiated the NE-induced protein synthesis. (C–E) PI3K was required for the R18-induced protein synthesis, and ERK1 ⁄ 2 for the NE-induced protein syn- thesis. Cardiomyocytes were treated with or without propranolol (10 l M) plus LY294002 (LY, 10 lM) or PD98059 (PD, 10 lM), respectively, for 30 min and then stimulated with NE (10 l M) for 48 h, the protein synthesis was measured (n ¼ 3). The values shown are means ± SD and expressed as the fold of control, *P < 0.05; **P < 0.01. W. Liao et al. 14-3-3 Controls cardiomyocyte hypertrophy through GSK3b FEBS Journal 272 (2005) 1845–1854 ª 2005 FEBS 1847 was found in the culture medium of untreated myocytes. The ANP production was increased approximately threefold upon the treatment of NE (10 lm) in the pres- ence of propranolol (10 lm) for 40 h (expressed as the fold of control, 116.8 ± 6.3 ngÆmL )1 vs. the control group, P < 0.05, n ¼ 3), and about fourfold in the medium of AdR18-infected myocytes (165.6 ± 35.4 ngÆmL )1 , P < 0.01 vs. the Ad control group, n ¼ 3), indicating an enhanced production of ANP in these cells (Fig. 3A). Figure 3B shows that compared with the Ad control group, the level of ANP in the AdR18 + NE group was increased appromimately fivefold (204.8 ± 23.3 ngÆmL )1 , n ¼ 3), fourfold in the AdR18 group and threefold in the Ad + NE group. Compared with the Ad + NE group, the level of ANP in the AdR18 + NE group was increased about 1.5-fold (P<0.05, n ¼ 3), indicating that R18 enhanced the NE-induced ANP production. Furthermore, we determined whether PI3K was required for R18 enhancement of ANP production; as in protein synthesis. As shown in Fig. 3C–E, treatment with LY (10 lm), but not with PD (10 lm), markedly blocked the R18-induced ANP expression (33.6 ± 0.3 ngÆmL )1 , vs. the AdR18 or the AdR18 + NE group, respectively, P < 0.05, n ¼ 3), whereas the NE-induced ANP production was blocked by PD, not by LY (the NE + PD group 45.37 ± 12.46 ngÆmL )1 vs. the NE group, P < 0.01, n ¼ 3). PKB and GSK3b phosphorylation are induced by R18 and blocked by PI3K inhibitor Glycogen synthase kinase-3 beta (GSK3b), a down- stream signaling molecule of the PI3K ⁄ PKB pathway, and ERK1 ⁄ 2 play very important roles in the regula- tion of hypertrophic response. Phosphorylated ERK1 ⁄ 2 (the active form of the enzyme) positively regulates the hypertrophic response, while dephosphorylated GSK-3b (the active form of the enzyme) negatively regulates the hypertrophic response [22–25]. This caused us to speculate whether these signaling mole- cules are involved in the AdR18-induced cardiomyocyte hypertrophy. The effect of R18 on ERK1 ⁄ 2, PKB and GSK3b phosphorylation is shown in Fig. 4. Activation of cardiac a 1 -AR significantly increased the ERK1 ⁄ 2 phosphorylation compared with the control group (Fig. 4A). The infection of AdR18 in cardiomyocytes had no effect on the ERK1 ⁄ 2 phosphorylation treated either with or without NE. However, the infection of AdR18 in cardiomyocytes markedly induced the PKB and GSK3b phosphorylation. Compared with the Ad control, AdR18 induced about twofold increase on the GSK3b phosphorylation (n ¼ 3, P < 0.05), and activation of a1-AR with NE (in the presence of 10 lm propranolol to block beta-ARs) also induced about a twofold increase (Fig. 4B), but the PKB phospho- rylation was not induced by the treatment of NE 0 2 4 6 CON NE Ad AdR18 CON NE NE+PD NE+LY ANP expression fold of control ANP expression fold of control * ** A 0 2 4 6 Ad AdR18 Ad AdR18 AdR18 AdR18+NEAd+NE ANP expression fold of control ANP expression fold of control * B 0 2 4 6 Ad AdR18 AdR18+LY AdR18+PD ANP expression fold of control ** C 0 2 4 ** D 0 2 4 6 +NE AdR18 +NE +LY AdR18 +NE +PD ** E Fig. 3. R18 induced ANP expression and enhanced the NE-induced ANP expression in cardiomyocytes in a PI3K-dependent manner. Cardio- myocytes cultured in 24-well plates were infected with or without AdR18 or Ad at an MOI of 10. After starvation for 24 h and treatment with propranolol (10 l M) and different inhibitors for 30 min, cells were stimulated with NE (10 lM) for 40 h. The culture medium was collec- ted for ANP assay using an ELISA kit. (A and B) R18 induced ANP production, and also enhanced the NE-induced ANP production. (C–E) PI3K was responsible for the role of R18, and ERK1 ⁄ 2 responsible for the NE-induced ANP production. Cardiomyocytes were treated with or without propranolol (10 l M) plus LY294002 (LY, 10 lM) or PD98059 (PD, 10 lM) for 30 min and stimulated with NE (10 lM) for 40 h. Then, the ANP production was measured. The values shown were means ± SD and expressed as the fold of control. The level of ANP in control was 40.25 ± 3.23 ngÆmL )1 ,*P < 0.05; **P <0.01(n ¼ 3). 14-3-3 Controls cardiomyocyte hypertrophy through GSK3b W. Liao et al. 1848 FEBS Journal 272 (2005) 1845–1854 ª 2005 FEBS (Fig. 4A). The AdR18-induced PKB and GSK3b phosphorylation was completely blocked by the PI3K inhibitor LY (10 lm, n ¼ 3, P < 0.05, compared with the AdR18 treatment only), but the NE-induced GSK3b phosphorylation was not blocked by LY. Taken together, these results indicate that the regu- lation of GSK3b phosphorylation is involved in R18-induced cardiomyocyte hypertrophy. R18 converts NFAT3 into faster mobility forms and induces its nuclear translocation NFAT3, a member of the nuclear factor of activated T cells (NFAT) family, plays a pivotal role in cardio- myocyte hypertrophy [26]. It is phosphorylated by activated GSK3b (dephosphorylated form). As the infection of AdR18 induced GSK3b phosphorylation – and thus inactivation – in isolated cardiomyocytes, we hypothesized that AdR18 expression may result in the dephosphorylation of NFAT3, inducing faster gel mobility. Figure 5 shows that AdR18 indeed converts NFAT3 into the faster mobility forms and this effect is abolished by cyclosporin A (400 nm), an inhibitor of calcineurin. Next, we examined the cellular localization of NFAT3 by immunofluorescence analysis. As shown in Fig. 6A, NFAT3 was present predominantly in the nucleus upon the treatment of AdR18, but was mainly found in the cytoplasm of the control and Ad group. To confirm the above results, cytoplasmic and nuclear extracts were prepared for western blot analysis with an anti-NFAT3 Ig. Clearly, the nuclear fraction of NFAT3 was increased upon the treatment with AdR18 (Fig. 6B). Together, these results indicate that the localization of NFAT3 can be regulated by the treat- ment with AdR18. Discussion 14-3-3 proteins are a family of regulatory molecules that are found ubiquitously in eukaryotes. Through interaction with target proteins, 14-3-3 proteins partici- pate in regulation of cell cycle, intracellular signal transduction, cytoskeletal structure and apoptosis. In A ERK1/2 GSK3β Ad AdR18 Phospho-GSK3β Phospho-ERK1/2 NE Phospho-PKB PKB AdR18 NE Phospho-GSK3β GSK3β LY Phospho-PKB PKB B 0 1 2 3 4 CON NE Ad Ad +NE AdR18 AdR18 +NE fold of control GSK3β phosphorylation fold of control GSK3β phosphorylation * * 0 1 2 3 4 con AdR18 AdR18 +LY NE NE +LY * Fig. 4. R18 induced PKB and GSK3b phosphorylation, which was blocked by PI3K inhibitor, LY294002. (A) Cardiomyocytes were infected with or without AdR18 or Ad and 24 h later, the cells were serum-starved for 24 h prior to treatment with propranolol (10 l M) as well as LY294002 (LY, 10 l M) for 30 min, and then treated with or without NE (10 l M) for 10 min. Phosphorylated PKB, GSK3b and ERK1 ⁄ 2 were detected by western blot with antibodies to phos- pho-Ser473 PKB, phospho-Ser9 GSK-3b and phospho-ERK1 ⁄ 2. The same membranes were stripped and re-probed with general GSK- 3b and ERK1 ⁄ 2 antibody. (B) The data is means ± SD and expressed as the fold of control, *P < 0.05 (n ¼ 3). CON Ad AdR18 AdR18 +CysA NFAT3 Fig. 5. R18 converted NFAT3 into the faster mobility forms. Neona- tal cardiac myocytes were infected with or without Ad or AdR18 in the presence or absence of cyclosporin A (Cys A, 400 n M)for 30 min. The whole cell lysate from these cells was subject to west- ern blot (6% gel) with anti-NFATc3 Ig. The experiment was repea- ted three times with the same result. W. Liao et al. 14-3-3 Controls cardiomyocyte hypertrophy through GSK3b FEBS Journal 272 (2005) 1845–1854 ª 2005 FEBS 1849 the present investigation, we have evaluated the role of 14-3-3 in cardiomyocyte hypertrophy by using an adenovirus vector expressing the YFP-R18 fusion pep- tide (AdR18) to inhibit 14-3-3 interactions. Compared with dominant-negative forms of 14-3-3s, the use of a global inhibitor of 14-3-3 provides a more complete view of the role of these proteins [20,21]. While some isoforms of 14-3-3 proteins were found in the whole rat heart by using northern blot and west- ern blot analysis previously [27], our results demon- strate that 14-3-3c, e, b and f isoforms are expressed in cultured neonatal rat cardiomyocytes. R18 markedly increased protein synthesis and ANP production and also potentiated the a 1 -AR-mediated protein synthesis and ANP production. These were decreased by PI3K inhibition, but not by ERK1 ⁄ 2 inhibition. In addition, R18 induced both PKB and GSK3b phosphorylation, which was blocked completely by LY294002, whereas NE only induced GSK3b phosphorylation, which was not blocked by LY294002. Lisa et al. have reported that the a 1 -AR-induced GSK3b phosphorylation is mediated by PKC, but not by PI3K [25]. Further, we found that NFAT3, a member of the nuclear factor of activated T cells family, was converted into the dephosphorylated, faster mobility forms, and translo- cated into the nucleus upon AdR18 treatment. These results indicate that the PI3K ⁄ PKB ⁄ GSK3b and NFAT pathway is probably involved in the hyper- trophic response induced by R18. Using the R18 peptide as an inhibitor of 14-3-3, pre- vious work has shown that the R18 peptide negatively regulates early Xenopus development and induces apoptosis under some apoptotic stimulation [20,21]. Using dominant-negative (DN)-14-3-3 transgenic mice as model, Muslin et al. found that transgenic mice, after transverse aortic constriction, developed signifi- cant cardiac hypertrophy and left ventricular dilation, and the survival of these mice decreased markedly [18]. Until now, the effect of 14-3-3 on cardiomyocyte hypertrophy has not been reported. In this study, R18 treatment increased markedly protein synthesis and ANP production in cardio- myocytes, which was blocked by LY294002 but not by PD98059. In addition, R18 potentiated the NE- induced protein synthesis and enhanced the NE-induced ANP production. The effects of R18 on NE-induced hypertrophy were not caused by inhibiting 14-3-3 expression, because 14-3-3 protein levels were not altered upon the stimulation with NE. To our sur- prise, the protein synthesis in the AdR18 + NE group was blocked by either LY294002 or PD98059 but the ANP production in this group was blocked only by LY294002 and not by PD98059. The reason for this difference was attributed to the probability that only a Ad CON AdR18 YFP Cy5 Hoechst Merge A NFAT3 cytoplasm CON Ad AdR18 CON Ad AdR18 nucleus B Fig. 6. R18 induces NFAT3 nuclear localiza- tion. (A) Cardiomyocytes grown on glass coverslips were infected with or without AdR18 at an MOI of 10 and then starved for 24 h. After fixation, the cellular localization of NFAT3 was detected using an antibody against rabbit NFAT3. After washing in NaCl ⁄ P i , samples were incubated with Cy5- conjugated goat anti-(rabbit IgG) Ig (red) plus Hoechst 33342 (blue) and examined by con- focal microscopy. NFAT3 was predominantly localized in the nucleus upon the treatment of AdR18, whereas, in the CON and Ad group, NFAT3 was mainly localized in the cytoplasm. Scale Bar, 16 lm. (B) Cardio- myocytes were infected with Ad and AdR18, respectively, and then starved for 24 h. Cytoplasmic and nuclear protein extra- ction were prepared and subject to western blot analysis using anti-NFAT3 Ig. The experi- ment was repeated two times with the same result. 14-3-3 Controls cardiomyocyte hypertrophy through GSK3b W. Liao et al. 1850 FEBS Journal 272 (2005) 1845–1854 ª 2005 FEBS portion of the signaling molecules and transcription factors modulated by 14-3-3 proteins were shared by the processes of protein synthesis and ANP produc- tion. In addition, we found that the effect of NE on ANP production was not blocked by LY alone, but the combination of NE and AdR18 is inhibited by LY to a level even greater than that of NE alone. On the other hand, PD could inhibit the effect of NE alone, but could not affect the combination of NE and AdR18 on the ANP production (Fig. 3D,E). These results suggest that cross talk may occur between NE and R18 in regulation of ANP expression. The mech- anism of this cross talk remains to be clarified. One of the established roles of 14-3-3 proteins is to inhibit apoptosis. The disruption of 14-3-3 interactions has been shown to lower the apoptotic threshold of cells. Interestingly, we found that R18 induced cardio- myocyte hypertrophy, and the phosphorylation of GSK3b on Ser9 was involved in this hypertrophic response. Similarly, a previous study has revealed that the activation of the Fas receptor, another molecule related to apoptosis, could induce cardiomyocyte hypertrophy, which also was dependent on the inacti- vation of GSK3b by Ser9 phosphorylation [28]. GSK3b is an established target of the PI3K ⁄ PKB signaling pathway, where PKB phosphorylates and thereby inactivates GSK3b. Phosphorylation and inacti- vation of GSK3b, a negative regulator of cardiomyocyte hypertrophy, has been identified to be necessary and suf- ficient for the hypertrophy induced by hypertrophic stimuli [25,29]. GSK3b phosphorylated various cellular substrates, including glycogen synthase, cyclin D1, c-Jun, and NFAT. Phosphorylation of cellular sub- strates by GSK3b either directly suppressed enzyme activities or changed subcellular localizations [30]. NFAT3 plays a crucial role in cardiomyocyte hypertro- phy. NFAT phosphorylation by GSK3b leads to NFAT interaction with 14-3-3 proteins, causing the redistribu- tion of NFAT from the nucleus to the cytoplasm. This results in the subsequent inhibition of NFAT-mediated transcription [26,31]. In our study, we found that R18 could convert NFAT3 into the faster mobility forms (unphosphorylated NFAT). Cyclosporin A, an inhibitor of calcineurin, abolished this effect of AdR18 on NFAT3. In addition, R18 could induce the nuclear localization of NFAT3. Therefore, the R18-induced hypertrophy is probably caused by one or all of the fol- lowing mechanisms: (a) R18 removes the negative con- straint of GSK3b on NFAT; (b) R18 disrupts the NFAT)14-3-3 interaction and inhibits the protective role of 14-3-3 on phosphorylated NFAT; (c) R18 pre- vents NFAT translocation from nucleus to cytoplasm. Figure 7 shows a working model depicting the effects of 14-3-3 on these molecules. In this model, NFAT is a pivotal molecule and R18 disrupts the balance between the unphosphorylated and phosphorylated forms of NFAT. However, it is probable that R18 induced cardio- myocyte hypertrophy involves disruption of 14-3-3 inter- action with other binding proteins such as PI3K. As R18 inhibits 14-3-3 proteins in an isoform-independent manner, the role of each isoform of 14-3-3 in cardio- myocyte hypertrophy remains to be elucidated. In summary, our findings establish that several iso- forms of 14-3-3 proteins (c, e, b and f) are expressed in rat cardiomyocytes. We have also shown that 14-3-3 inhibits cardiomyocyte hypertrophic responses and negatively regulates the a 1 -AR-induced hypertrophy, in which the PI3K ⁄ PKB ⁄ GSK3b and NFAT pathway is likely involved. The regulation of GSK3b phosphoryla- tion and the compartmentation of NFAT by 14-3-3 probably contributes to this process. Experimental procedures Materials The ERK1 ⁄ 2 inhibitor (PD98059), PI3K inhibitor (LY294002), propranolol and norepinephrine (NE) were Hypertrophic stimuli 1 -ARNE Cytoplasm NFAT Nucleus PKC Hypertrophy 14-3-3 calcineurin Cys A PKB -ser-9-P GSK3 PI3K P NFAT 14 - 3 - 3 14 - 3 - 3 P NFAT GSK3 Hypertrophic stimuli 1 -ARNE 1 -ARαNE Cytoplasm NFAT Nucleus PKCPKC Hypertrophy 14-3-314-3-3 calcineurincalcineurin Cys A PKBPKB -ser-9-P Active Inactive GSK3GSK3β PI3KPI3K P NFAT PP NFAT 14 - 3 - 3 14 - 3 - 3 14 - 3 - 3 P NFAT PP NFAT GSK3GSK3β Fig. 7. A working model depicts 14-3-3 proteins inhibiting the cardio- myocyte hypertrophy. Upon stimulation, PKB is phosphorylated via activated PI3K and GSK3b is phosphorylated via both PKC and PI3K, leading to GSK3b inhibition. The active, dephosphorylated GSK3b phosphorylates NFAT and counteractes the effect of calcineurin on NFAT. 14-3-3 Proteins inhibit PI3K and activate GSK3b, keeping NFAT in cytoplasm by binding to phosphorylated NFAT. R18 induces cardiomyocyte hypertrophy in part by removal of the modulatory effect of 14-3-3 on PI3K, GSK3b , and NFAT, leading to transcrip- tional activation of NFAT in nucleus. NE, norepinephrine; Cys A, cyclosporin A; PI3K, phosphoinositide 3-kinase; NFAT, nuclear factor of activated T cells PKB, protein kinase B. W. Liao et al. 14-3-3 Controls cardiomyocyte hypertrophy through GSK3b FEBS Journal 272 (2005) 1845–1854 ª 2005 FEBS 1851 purchased from Sigma Chemical Co. (St Louis, MO, USA). Terminal deoxynucleotidyl transferase (TDT) was from Invitrogen Corporation (Carlsbad, CA, USA). [ 3 H]Leucine was from Amersham Biosciences (Little Chalfont, Bucks, UK). Other reagents were obtained from commercial sup- pliers. Isolation and culture of neonatal ventricular myocytes Procedures with experimental animals followed the National Institute of Environmental Health Sciences Animal and Use Committee guidelines. Primary cultures of cardio- myocytes were prepared from the ventricles of 1-day-old Sprague–Dawley rats (from the experiment animal depart- ment of the Medical Science Center, Peking University, Beijing, China) by enzymatic digestion in 0.1% trypsin, 0.03% collagenase II as described previously [32]. Neonatal rats were put into a glass beaker containing a cotton mass wetted with ethyl ether. After anaesthesia and decapitation, hearts were taken out immediately and put into ice-cold NaCl/Pi, and then cut into pieces. Cells in suspension were collected after several rounds of digestion of heart pieces, then divided into several 100-mm culture dishes and incuba- ted for 1 h. The suspension containing unattached cardio- myocytes was then collected and seeded at a density of 1.5 · 10 5 cellsÆcm )2 in culture media (Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum, 0.1 mm 5-bromodeoxyuridine, 50 lgÆmL )1 penicillin and 50 lgÆ mL )1 streptomycin). After incubation at 37 °C in humid air with 5% (v ⁄ v) CO 2 for 24 h, the cardiomyocytes were then deprived of serum and incubated for another 24 h before treatment. Cells were preincubated with 10 lm propranolol to block b-adrenergic receptors with or without different inhibitors for 30 min before stimulation with 10 lm NE. Recombinant adenovirus vectors The pla smid containing R18 peptide, pAAV-EYFP-R18 was made by subcloning the  100 bp NheI ⁄ XhoI fragment of pSCM-136 plasmid into the  4.5 kbp XbaI ⁄ XhoI fragment o f pAAV-MCS (Stratgene, Heidelberg, Germany), and the pAAV-EYFP w as made by subcloning the  800 bp Nhe I ⁄ Hin- dIII fragment of pEYFP-C1 into the  4.5 kbp XbaI ⁄ HindIII fragment of pAAV-MCS. The adenovirus shuttle constructs pAdTrack-EYFP-R18 and pAdTrack-EYFP were made by subcloning the BamHI ⁄ XhoI fragments of pAAV-EYFP-R18 and pAAV-EYFP, respectively, into pAdTrack-cytomegalo- virus (CMV) digested with BglII ⁄ XhoI. Recombinant adeno- viruses expressing EYFP-R18 (AdR18) or EYFP (Ad, as a control) were constructed using a method described previ- ously [33]. Briefly, shuttle construct was linearized with PmeI and el ectr opora ted i n to Es cherichia coli BJ51 83 (ATCC, Manassas, VA, U SA) together with the adenoviral backbone plasmid pAdEasy-1. Homologous recombinants were selected and were identified by restriction analysis. Finally, the PacI- linearized reco mbinant was transfected into HEK293A (ATCC) packaging cells. The adenoviruses produced were used to infect additional HEK293A cells, and a h igh titer adenovirus stock was made following several r ounds of amplification. All recombinant adenoviruses were tested for transgene expression in cardiac myocytes by reverse transcriptase-polymerase chain r eaction and western blot. Cardiomyocytes were infected with AdR18 or Ad at a multi- plicity of infection (MOI) of 10 for 24 h and then subjected to experiments after deprived of serum for 24 h. Northern blot analysis The total cellular RNA was extracted from cardiomyocytes using a total RNA isolation system kit (Promega Corp., Madison, WI USA). The total RNA (15 lg) was separated on a horizontal 1.0% agarose ⁄ 2.2 m formaldehyde gel and transferred onto a nylon membrane (Millipore Corp., Bill- erica, MA, USA). The membrane was then hybridized with probe at 42 °C overnight, washed and autoradiographed [34]. The synthesized 45-mer oligonucleotide probes were labeled using terminal deoxynucleotidyl transferase with [ 32 P]dATP[aP]. The sequences of probes are as follows: 14-3-3f probe: 5¢-TGAGTGTAGTCTGTGTGGGTACTG TAAGGCTTGGAGCACTTGTGA-3¢;14-3-3h probe: 5¢-TC CTCTAGCAAGGAAGCCCATTCATGTGTATGGGGTC AACTGTTT-3¢; 14-3-3b probe: 5¢-GTCTATTGAGCTCT GTGATCTGTTTGGTGTCACTGTATCCTCCAC-3¢; 14-3-3c probe: 5¢-CAGGTGGACTGGCAGCGCACGCTGATGC TACTACTGCAGTCTTTA-3¢; 14-3-3e probe: 5¢-ACCTAA AGCTGGGACCAGTAAAATCCACAGAAATTCACTCT TGCC-3¢; 18sRNA probe: 5¢-ACGGATTCTGATCGTCTT CGAACC-3¢. Western blot analysis Cells seeded on 30-mm plates were washed once with ice- cold NaCl ⁄ P i at the appropriate time after treatment, and lysed in 0.15 mL lysis buffer [20 mm Tris ⁄ HCl, pH 7.4, 100 mm NaCl, 10 mm sodium pyrophosphate, 5 mm EDTA, 50 mm NaF, 1 mm sodium vandate, 0.1% (w ⁄ v) SDS, 10% (w ⁄ v) glycerol, 1% (v ⁄ v) Triton X-100, 1% (w ⁄ v) sodium deoxycholate] containing 1 lm leupeptin, 0.1 lm aprotinin, 1 mm phenylmethanesulfonyl fluoride and 1 lm pepstatin. Protein concentration was calculated using the BCA protein assay kit (Pierce Biotechnology, Inc., Rockford, IL, USA). Protein was loaded onto a 10% SDS ⁄ polyacrylamide gel and electrophoretically transferred to nitrocellulose membranes (Pall Corporation, East Hill, NY, USA), analyzed with antibodies according to the supplier’s protocol, and visualized with peroxidase and an enhanced-chemiluminescence system (ECL kit, Pierce Biotechnology, Inc.). The following antibodies were used in this study: anti-14-3-3b, anti-14-3-3c, anti-14-3-3e, 14-3-3 Controls cardiomyocyte hypertrophy through GSK3b W. Liao et al. 1852 FEBS Journal 272 (2005) 1845–1854 ª 2005 FEBS anti-14-3-3f, anti-eIF-5, anti-GSK3b and anti-NFATc3 (1 : 1000 dilution, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), and anti-ERK1 ⁄ 2 (1 : 2000 dilution, Upstate Biotechnology, Charlottesville, VA, USA), anti- PKB, anti-(Ser473-phospho-PKB), anti-(Ser9-phospho- GSK3b), anti-(Thr202 ⁄ Tyr204-phosph o-ERK1 ⁄ 2) Igs (1 : 1000 dilution, Cell Signaling Technology, Inc., Beverly, MA, USA). Immunofluorescence and confocal microscopic assay Cardiomyocytes grown on glass coverslips in six-well dishes were infected with or without AdR18 for about 24 h and then starved for 24 h. After washing with 37 °C NaCl ⁄ P i , cells were fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, and incubated with an anti- NFAT3 Ig (1 : 250) at 4 °C overnight, and Cy5-conjugated AffiniPure Goat anti-(rabbit IgG) Ig (Jackson Immuno- Research, West Grove, PA, USA) (1 : 500) at 37 °C for 1 h. Cells were counterstained with 5 lgÆmL )1 Hoechst 33342 (Sigma-Aldrich) to visualize the nucleus. Microscopic images were acquired using a Leica Confocal Microscope. Cytoplasmic and nuclear protein extract preparation Cardiomyocytes cultured in 10-cm plates were infected with Ad and AdR18, respectively, at an MOI of 10, and then starved for 24 h. Cytoplasmic and nuclear protein extrac- tions were prepared according to the instructions of NE-PER Nuclear and Cytoplasmic Extraction Reagents kit (Pierce Biotechnology, Inc.). Briefly, cells were washed twice with ice-cold NaCl ⁄ P i , recovered by scraping, then pelleted and resuspended in 0.2 mL ice-cold CER I contain- ing protease inhibitors (Halt Protease Inhibitor Cocktail Kit, Pierce Biotechnology). Cells were broken by vortexing vigorously and then adding 11 lL ice-cold CER II and vortexed vigorously again. After centrifugation (5 min at 16 000 g,4°C), the supernatant (cytoplasmic extract) was collected and the insoluble fraction containing nuclei was resuspended in 0.1 mL ice-cold NER containing protease inhibitors. After four rounds of vortexing (15 s) and incu- bating on ice (10 min), then centrifuging for 10 min at  16 000 g,4°C, the supernatant (nuclear extract) fraction was collected. After protein quantification, cytoplasmic and nuclear proteins (30 lg) were electrophoresed on an 8% SDS ⁄ polyacrylamide gel, transferred to nitrocellulose, and immunoblotted as described above. Atrial natriuretic peptide (ANP) enzyme-linked immunosorbent assay Cardiomyocytes cultured in 24-well plates were preincu- bated with different inhibitors for 30 min and treated with NE in serum-free medium for 40 h. The supernatants were collected for the ANP assay using an ELISA kit (Phoenix Pharmaceuticals Inc., Belmont, CA, USA) following the manufacturer’s instruction. Protein synthesis assay ([ 3 H]leucine incorporation) Cardiomyocytes cultured in 24-well plates were serum deprived for 24 h, pretreated with or without a variety of inhibitory agents, and then incubated for 48 h with NE in serum-free medium [ 3 H]leucine (1 lCiÆmL )1 ) was added 6 h before the harvest. At the end of the incubation, the plates were quickly washed twice with ice-cold NaCl ⁄ P i , kept for 30 min with ice-cold 10% (v ⁄ v) trichloroacetic acid at 4 °C, and washed with NaCl ⁄ P i . Precipitates were solubilized in 0.1 m NaOH with gentle shaking at 37 °C for 1 h. The radioactivity incorporated into trichloroacetic acid-precipita- ble materials was determined by liquid scintillation spectro- metry (Beckman Coulter Inc., Fullerton, CA, USA). Statistical analysis All data represent the mean ± SD of at least three inde- pendent experiments. The analysis of variance (anova) was performed for the comparison of three or more groups and the post-test comparison was performed by the method of Tukey. A value of P < 0.05 was accepted as significant. Acknowledgements The authors wish to thank Prof. Haian Fu (Pharmacol- ogy Department at Emory University, USA) for the generous gift of pSCM136 and pEYFP-C1 plasmids and Lisa M. Cockrell (Emory University) for critical reading of the manuscript. This work was supported by grants from the foundation of national key basic research and development project (G2000056906) and national nat- ural science foundation (30270540, 30200321). References 1 Fu H, Subramanian RR & Masters SC (2000) 14-3-3 proteins: structure, function, and regulation. Annu Rev Pharmacol Toxicol 40, 617–647. 2 Ferl RJ, Manak MS & Reyes MF (2002) The 14-3-3s. Genome Biol 3, 3010.1–3010.3010.7. 3 Rubio MP, Geraghty KM & Wong BH (2004) 14-3-3- affinity purification of over 200 human phosphoproteins reveals new links to regulation of cellular metabolism, proliferation and trafficking. Biochem J 379, 395–408. 4 Petosa C, Masters SC, Bankston LA, Pohl J, Wang BC, Fu H & Liddington RC (1998) 14-3-3 f Binds a W. Liao et al. 14-3-3 Controls cardiomyocyte hypertrophy through GSK3b FEBS Journal 272 (2005) 1845–1854 ª 2005 FEBS 1853 phosphorylated Raf peptide and an unphosphorylated peptide via its conserved amphipathic groove. J Biol Chem 273, 16305–16310. 5 Hallberg B (2002) Exoenzyme S binds its cofactor 14-3-3 through a non-phosphorylated motif. Biochem Soc Transactions 30, 401–405. 6 Berg D, Holzmann C & Riess O (2003) 14-3-3 Proteins in the nervous system. Nature 4, 752–762. 7 Tzivion G & Avruch J (2002) 14-3-3 Proteins: Active cofactors in cellular regulation by serine ⁄ threonine phosphorylation. J Biol Chem 277, 3061–3064. 8 Zhang L, Chen J & Fu H (1999) Suppression of apo- ptosis signal-regulating kinase 1-induced cell death by 14-3-3 proteins. Proc Natl Acad Sci USA 96, 8511– 8515. 9 Goldman EH, Chen L & Fu H (2004) Activation of apoptosis signal-regulating kinase 1 by reactive oxygen species through dephosphorylation at serine 967 and 14-3-3 dissociation. J Biol Chem 279, 10442–10449. 10 Subramanian RR, Zhang H, Wang H, Ichijo H, Miyashita T & Fu H (2004) Interaction of apoptosis signal-regulating kinase 1 with isoforms of 14-3-3 proteins. Exp Cell Res 294, 581–591. 11 Zhang R, He XR & Liu WM (2003) AIP1 mediates TNF-a-induced ASK1 activation by facilitating dissoci- ation of ASK1 from its inhibitor 14-3-3. J Clin Invest 111, 1933–1943. 12 Hekman M, Wiese S, Metz R & Albert S (2004) Dynamic changes in C-Raf phosphorylation and 14-3-3 protein binding in response to growth factor stimula- tion: differential roles of 14-3-3 protein binding sites. J Biol Chem 279, 14074–14086. 13 Light Y, Paterson H & Marais R (2002) 14-3-3 antago- nizes Ras-mediated Raf-1 recruitment to the plasma membrane to maintain signaling fidelity. Mol Cell Biol 22, 4984–4996. 14 Timothy A & Zhang CL (2001) Identification of a signal-responsive nuclear export sequence in class II histone deacetylases. Mol Cell Biol 21, 6312–6321. 15 Sekimoto T, Fukumoto M & Yoneda Y (2004) 14-3-3 suppresses the nuclear localization of threonine 157- phosphorylated p27 (Kip1). EMBO J 23, 1934–1942. 16 Datta SR, Katsov A, Hu L, Petros A, Fesik SW, Yaffe MB & Greenberg ME (2000) 14-3-3 Proteins and survi- val kinases cooperate to inactivate BAD by BH3 domain phosphorylation. Mol Cell 6, 41–51. 17 Yang HZ, Masters SC, Wang HN & Fu H (2001) The proapoptotic protein Bad binds the amphipathic groove of 14-3-3f. Biochimica Biophysica Acta 1547, 313–319. 18 Xing HM & Zhang SS (2000) 14-3-3 proteins block apoptosis and differentially regulate MAPK cascades. EMBO J 19, 349–358. 19 Wang B, Yang H, Liu YC, Jelinek T, Zhang L, Ruoslahti E & Fu H (1999) Isolation of high-affinity peptide antagonists of 14-3-3 proteins by phage display. Biochemistry 38, 12499–12504. 20 Wu CL & Muslin AJ (2002) Role of 14-3-3 proteins in early Xenopus development. Mechanisms Dev 119, 45–54. 21 Masters SC & Fu H (2001) 14-3-3 Proteins mediate an essential anti-apoptotic signal. J Biol Chem 276, 45193– 45200. 22 Yue TL, Gu JL, Wang CL & Reith AD (2000) Extracel- lular signal-regulated kinase plays an essential role in hypertrophic agonists, endothelin-1 and phenylephrine- induced cardiomyocyte hypertrophy. J Biol Chem 275, 37895–37901. 23 Carmine M, David Z & Gianluigi C (2000) The Akt-glycogen synthase kinase 3b pathway regulates transcription of Atrial natriuretic factor induced by b-adrenergic receptor stimulation in cardiac myocytes. J Biol Chem 275, 14466–14475. 24 Christopher L, Antos T & McKinsey N (2002) Acti- vated glycogen synthase-3b suppresses cardiac hypertro- phy in vivo. Proc Natl Acad Sci USA 99, 907–912. 25 Lisa MB, Tian PY, Lin HY, Jiang YP & Richard ZL (2001) Dual regulation of glycogen synthase kinase-3b by the a 1A -adrenergic receptor. J Biol Chem 276, 40910– 40916. 26 Julian C, Orlando F & Qiangrong L (2003) Targeted inhibition of p38 MAPK promotes hypertrophic cardio- myopathy through upregulation of calcineurin-NFAT signaling. J Clin Invest 111, 1475–1486. 27 Masahiko W, Toshiaki I & Tohru I (1994) Molecular cloning of rat cDNAs for the f and h subtypes of 14-3-3 protein and differential distributions of their mRNAs in the brain. Mol Brain Res 25, 113–121. 28 Cornel B, Hartmut R & Sven M (2002) Fas receptor signaling inhibits glycogen synthase kinase 3b and indu- ces cardiac hypertrophy following pressure overload. J Clin Invest 109, 373–381. 29 Stefan EH & Junichi S (2002) Glycogen synthase kinase-3b, a novel regulator of cardiac hypertrophy and development. Circ Res 90, 1055–1063. 30 Cohen P, C & Frame S (2001) The renaissance of GSK3. Nature 2, 769–776. 31 Eva R, Pieter A & Chiel C (2002) Requirement of nuclear factor of activated T-cells in calcineurin- mediated cardiomyocyte hypertrophy. J Biol Chem 277, 48617–48626. 32 Xu YJ & Gopalakrishnan V (1991) Vasopressin increases cytosolic free [Ca 2+ ] in the neonatal rat cardio- myocyte. Evidence for V1 subtype receptors. Circ Res 69, 239–245. 33 He TC & Zhou SB (1998) A simplified system for gener- ating recombinant adenoviruses. Proc Natl Acad Sci USA 95, 2509–2514. 34 Sambrook J, Fritsch EF & Maniatis T (2001) Molecular Cloning: A Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 14-3-3 Controls cardiomyocyte hypertrophy through GSK3b W. Liao et al. 1854 FEBS Journal 272 (2005) 1845–1854 ª 2005 FEBS . 14-3-3 Proteins regulate glycogen synthase 3b phosphorylation and inhibit cardiomyocyte hypertrophy Wenqiang Liao, Shuyi Wang, Chide Han and Youyi. at Ser473 and glycogen synthase 3b (GSK3b) at Ser9, but not extracellular signal-regulated kinase 1 ⁄ 2 (ERK1 ⁄ 2). AdR18-induced PKB and GSK3b phosphorylation