Recovery is a Wonderland docx

... information. Recovery is a Wonderland was first published in the 75th Anniversary Issue of the AA Grapevine, the official magazine of Alcoholics Anonymous, and in the book, “Emotional Sobriety” ... that had always been there; my descent into the abyss began. The abyss was the dark void of pain, shame, fear and loneliness that had always existed within me. Drinking alcohol somehow made everything ... reading assignments from approved literature, practice exercises and speaker tapes by other members in the recovery community including Alcoholics Anonymous, Narcotics Anonymous, and Al-Anon.Stepworkshop.com...

There is a Reaper ... docx

... said. "The realities I knew no longer exist, and I amdamp and cold. All about me is a sense of gloom and dejection. It is anapprehension—an emanation—so deep and real as to be almost a ... that and youmay come to a wrong conclusion as to what the worst menace is Richard KadreyButcher BirdSpyder Lee is a happy man who lives in San Francisco and owns a tattoo shop. One night an ... It is an intangible and evasive—thing—but veryreal. And it is coming closer! It has no organs of sight as I know them,but I feel that it can see me. Or rather that it is aware of me with a sensesharper...

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... 5-ACATTGTGCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAGAATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATCAGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAGAGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATGAGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3.AcknowledgementThis ... SJ, Ward ER, RyalsJA & Dangl JL (1994) Arabidopsis mutants simulatingdisease resistance response. Cell 77, 565–577.26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K,Miyao A, Kawasaki T, ... PTI1-4(At2g47060) was cloned in the pBD-GAL4 cam (Stratagene,La Jolla, CA, USA) and were each used as bait to screen anArabidopsis pACT2 cDNA library [36]. The yeast strainPJ69- 4A [37] containing...

Tài liệu A Practical Guide to Business Continuity & Disaster Recovery with VMware Infrastructure docx

... are compatible with all standard x86 computers. • Isolation. Virtual machines are isolated from other each other as if physically separated. • Encapsulation. Virtual machines encapsulate a complete ... most crucial after data replication. While it is true that the isolation and encapsulation features of a virtual machine make BCDR substantially easier – just replicating the storage is only ... Continuity & Disaster Recovery Page 42 An alternative approach might be to replicate the VirtualCenter instance. This has the initial disadvantage in having to re-register any ESX hosts...

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ PDIP46(2) ⁄ SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ⁄ PDIP46(1) ⁄ SKAR (a) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ... GCGGGATCCCTCAGCCCATTGGAAGGCACCATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAGpYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2 ⁄ PDIP46⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAGATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGTpYESTrp2...

Tài liệu What is a high school worth?: A model of Australian private secondary school fees docx

... Curriculum and assessment Authority (VCAA) manages and awards school qualifications. It administers and awards two senior school secondary qualifications known as the Victorian Certificate of education ... and students with a language background other than English. The average ICSEA value is 1000 and the lower the value the more disadvantaged is the school. Table 5: Comparisons across Secondary ... Associated Schools (bas) It is a group of schools in Ballarat, that provides the basis for interschool sporting competition Ballarat and Clarendon College; Ballarat and Queens Anglican Grammar...

Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

... USAEmail: Min Liu - corticalgranules@hotmail.com; Andrea Oh - andrea.oh@email.ucr.edu; Patricia Calarco - calarco@itsa.ucsf.edu; Michiyuki Yamada - myamada@yokohama-cu.ac.jp; Scott A Coonrod - scc2003@med.cornell.edu; ... uterus,spinal cord, salivary glands, and pancreas [43]. PAD I andPAD III are expressed in epidermis and hair follicles (PADIII) [43]. Mouse PAD IV has a potential nuclearlocalization sequence and is ... features andinvolvement in disease. Bioessays 2003, 25:1106-1118.25. Nakashima K, Hagiwara T, Yamada M: Nuclear localization ofpeptidylarginine deiminase V and histone deimination ingranulocytes....

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 wasconstructed to contain SUT2 as ... 5¢-TGACGCTCACCAAGCTATTGGTTTGTTTGGATCAATCGTCAGATATGAAGGCATAGGCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TATTAATATTCCTATATTTTACATAGGAGGAAATTACATGCATGAAACCTACAGCTGAAGCTTCGTACGC-3¢, respectively. The plasmid pFL38-RAS2 was con-structed by ligating ... http://mips.gsf.de/proj/yeast/info/tools/hegemann/gfp.html) using the primersSUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3¢,...

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... asfollows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAATCACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACATCCTTGGTACCAGGTGATTTTTCTTGTGAAGAT.All experimental protocols described in this study wereapproved by ... 110, 151–164.26 Tomari S, Nagahama H, Shu Y, Hoshi S, NakayamaK, Nakayama KI & Nagata M (2002) Glomerular dif-ferentiation in p27 and p57 double-mutant metanephroi.Anat Embryol 206, 31–36.27 ... The data were deposited in GEOdatabase GSE2043 (a complete list of these genesappears in Table S1 and a partial list is shown inTable 1). Because only a single microarray was usedfor each...

Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase speciﬁc for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx

... 5¢-CACTTGAAGCTTTAAGGAGGAAtagACCATGCGTATCCGTGAGCTTGGCATCACC-3¢;antisen se primer, 5¢-ACGCAATCTAGAGTCAGCCCTCAGGGGGCTTTCG-3¢. The ampliﬁed PCR product wasdigested with HindIII and XbaI (Takara ... L-Ala-(Gly)2(L-Ala)2, L-Ala-D-Ala, L-Ala-D-Ala-L-Ala,DL-Ala-DL-Asn, DL-Ala-DL-Ile, DL-Ala-DL-Leu, DL-Ala-DL-Met, DL-Ala-DL-Phe, DL-Ala-DL-Ser, DL-Ala-DL-Val, L-Asp-D-Ala, L-Pro-Gly, L-Pro-L-Phe, c-Aminobutyryl-L-His ... of BapA andDmpA. The following compounds were not substrates for BapA:(Gly)2(Gly)3, D-Ala-Gly, D-Ala-(Gly)2(D-Ala)2, D-Ala-L-Ala (D-Ala)3(D-Ala)4, L-Ala-Gly, L-Ala-(Gly)2(L-Ala)2,...

Xem thêm

Từ khóa: Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM