Báo cáo hóa học: " Tuning the electronic properties of boron nitride nanotube by mechanical uni-axial deformation: a DFT study" docx
Báo cáo hóa học: " Tuning the electronic properties of boron nitride nanotube by mechanical uni-axial deformation: a DFT study" docx
... al.: Tuning the electronic properties of boron nitride nanotube by mechanical uni-axial deformation: a DFT study.Nanoscale Research Letters 2011 6:160.Submit your manuscript to a journal and ... by mechanical uni-axial deformation: a DFT studyShin-Pon Ju*, Yao-Chun Wang, Ting-Wei LienAbstract The effect of uni-axial strain on the electronic properties of (8,0) zigzag and (5,5) armchair ... device, the axiallength of CNT can be adjusted. For CNT with different uni-axial strains, they found that the electronic proper-ties of CNT can be affected by the uni-axial mechanical deformation....
- 11
- 408
- 0
báo cáo hóa học: " Comparing the immunosuppressive potency of naïve marrow stromal cells and Notch-transfected marrow stromal cells" docx
... assay (forward primer: TTGGTC TTACT-GACATCCACTTTG, reverse primer CAGACACTTTGAAGCCCTCAG, exo-NICD-specific probe [6-FAM]CCCAGTTCAATTACAGCTCTTAAGGCTAGAG[BHQ 1a- 6FAM])). Amplification signals were ... designed the study, performed immunoassays andflow cytometry, analyzed and interpreted data, and wrote the manuscript .CCT partici pated in data analysis and interpretation, performed statisticalanalysis, ... 25:2025-32.33. Park SJ, Nakagawa T, Kitamura H, Atsumi T, Kamimura D, Park SJ,Murakami M, Kitamura Y, Iwakura Y, Hirano T: IL-6 regulates in vivodendritic cell differentiation through STAT3 activation....
- 14
- 408
- 0
Báo cáo hóa học: " Characterization and Optical Properties of the Single Crystalline SnS Nanowire Arrays" pot
... that the SnS nanowires are a good single crystalline. The HRTEM image of a single SnSFig. 2 SEM images of AAOtemplate and SnS nanowirearrays. a Typical SEM image of AAO template. b and c The ... in a low magnification. dSEM image of a typical cross-sectionFig. 3 TEM images of AAOtemplate and SnS nanowirearrays. a The sample was etchedfor 10 h. b The SnS nanowireswith a diameter of ... image, the lattice fringes of the SnS are clear and uniform, andadditionally it confirmed that these single crystalline SnSnanowires are of high quality. The measured spacing of the crystallographic...
- 5
- 317
- 0
Báo cáo hóa học: "GEOMETRIC AND APPROXIMATION PROPERTIES OF SOME SINGULAR INTEGRALS IN THE UNIT DISK" doc
... USAE-mail address: ganastss@memphis.eduSorin G. Gal: Department of Mathematics, University of Oradea, Str. Armatei Romane 5,Oradea 410087, RomaniaE-mail address: galso@uoradea.ro14 Geometric and approximation ... (0,1].AcknowledgmentThis paper was written during the 2005 Spring Semester when the second author was a Visiting Professor at the Department of Mathematical Sciences, University of Memphis,Tenn, USA.G. A. Anastassiou ... Geometric and approximate properties of convolution polynomials in the unit disk, Bul-letin of the Institute of Mathematics. Academia Sinica 1 (2006), no. 2, 307–336.[6] P.T.Mocanu,T.Bulboaca,andGr.St.Salagean,Geometric...
- 19
- 286
- 0
Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf
... of the addi-tion was the total disappearance of specific resonanceswithout the concomitant appearance of other signalsin other parts of the spectrum. This result could be a consequence of the ... protein ratio, the resonances of Arg20, Asp22 and Asp23 disap-peared, and the resonance of Leu21 shifted. At a 2 : 1ratio, the resonances of residues 19 and 44 also disap-peared, whereas those of ... 4207Understanding the binding properties of an unusualmetal-binding protein) a study of bacterial frataxinChiara Pastore1, Marisa Franzese2, Filomena Sica2,3, Pierandrea Temussi1,2and Annalisa...
- 12
- 704
- 0
Báo cáo khoa học: On the aggregation properties of FMRP – a link with the FXTAS syndrome? pot
... decorated with stain, as well as clustered deposits of fibrils with an average diameter of 6 nm (Fig. 6C).FX1RP Nt-NES aggregates have a curved appearance,with an apparent average diameter of 10 nm ... (2010) Sam68 sequestration and partialloss of function are associated with splicing alterationsin FXTAS patients. EMBO J 29, 1248–1261.37 Garcia-Arocena D & Hagerman PJ (2010) Advances inunderstanding ... (2010) Functional interactions as a survivalstrategy against abnormal aggregation. FASEB J 25,45–54.32 Adrover M, Pauwels K, Prigent S, de Chiara C, Xu Z,Chapuis C, Pastore A & Rezaei H (2010)...
- 10
- 415
- 0
Báo cáo khoa học: "ON THE SUCCINCTNESS PROPERTIES OF UNORDERED CONTEXT-FREE GRAMMARS" ppt
... I. The reason is that the size of a grammar for the inverse homomorphic image of a language need only be polynomiaUy bigger than the size of a grammar for the language itself. The proof of ... proportional to n such that the instance has a vertex cover if and only if the string is generated by the grammar. He also notes that if all ID/LP grammars have fanout bounded by a fixed constant, then ... from the characters in z to the left. This is because of the "wraparound phenomenon": the u strings are iden- tical, so the z characters to the right of the boundary are the same characters...
- 5
- 294
- 0
Báo cáo khoa học: Altering the surface properties of baculovirus Autographa californica NPV by insertional mutagenesis of the envelope protein gp64 ppt
... 5-GATGACGAGCTCGACAAATGGGCGAAGGAAACGCTGCAAAAGGAC64-43-ELD-SacI-for 5-GATGACGAGCTCGGGCGGGGTAATGTCCAAG64-59-ELD-SacI-back 5-GATGACGAGCTCGACAAATGGGCGTACAACGAAAACGTGATTATCGG64-59-ELD-SacI-for 5-GATGACGAGCTCGTCCGTCTCCACGATGGTG64-148-ELD-SacI-back ... 5-GATGACGAGCTCGACAAATGGGCGACGGACGAGTGCCAGGTATAC64-180-ELD-SacI-for 5-GATGACGAGCTCGTCGTCCTGGCACTCGAGC64-234-ELD-SacI-back 5-GATGACGAGCTCGACAAATGGGCGAAAAATAACCCCGAGTCGGTG64-234-ELD-SacI-for 5-GATGACGAGCTCGTCATCTTTAATGAGCAGACACGB64-277-ELD-NotI-for ... 5¢-GATGACGAGCTCGACAAATGGGCGTGGCGCCACAACGTTAGAGC64-282-ELD-SacI-for 5¢ GATGACGAGCTCAGTGGGCGGCCGCTTCTTG64-283-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGCGCCACAACGTTAGAGCCAAG64-283-ELD-SacI-for 5¢-GATGACGAGCTCCCAAGTGGGCGGCCGCTTC64-290-ELD-SacI-back...
- 10
- 338
- 0
báo cáo hóa học:" Assessing the clinical utility of measuring Insulin-like Growth Factor Binding Proteins in tissues and sera of melanoma patients" potx
... (or Wilcoxon rank-sum test), the analysis of variance (ANOVA) test (orKruskal-Wallis test), and the Spearman-rank correlationcoefficient, as appropriate. For the analysis of histopatho-logic ... oversaw its design and coordination, supervised the analysis and interpretation of the data, and writing the manuscript. All authors read and approved the final man-uscript.Acknowledgements The ... tissue and sera Of the 82 sera samples analyzed by the IGFBP-3 ELISAassay, 20 were eliminated from analysis due to hemolysisand of the 62 remaining samples, 27 were from primarypatients and 35...
- 9
- 486
- 0
Từ khóa: the chart below shows the sleep patterns of people in five different occupations according to a canadian studybáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt pottài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdfbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caolam the nao de tom tat bao cáo khoa hocbai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfchuyên đề điện xoay chiều theo dạngBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ