báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot
... managed the VCT training program from the Caribbean; and to Barbara McGaw (The Caribbean HIV/ AIDS Regional Training network [CHART], Kingston, Jamaica), who oversaw the VCT training program. ... Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Bar-buda, Dominica, Grenada, and Turks & Caicos in 2005.Clinical Skills CourseData from the ... skills and advanced training skills, as well as the number of trainingseach clinical trainer and advanced trainer had conductedsince the training.Follow-Up ActivitiesDrawing on contact information...
- 8
- 450
- 0
Báo cáo sinh học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt
... a standard proce-dure as indicated in Materials and method. (D) Summary of proteolysis. The putative domains of CI and its amino acid residues involved in formation of hinge, NTD and CTD are ... palas2004@gmail.com; Malabika Das - malavika_das@rediffmail.com; Nitai C Mandal - mandalnc2003@yahoo.com; Subrata Sau* - sau@bic.boseinst.ernet .in * Corresponding author AbstractBackground: Lysogenic mode of ... Ganguly, Amitava Bandhu, Partho Chattoraj, Palas K Chanda, Malabika Das, Nitai C Mandal and Subrata Sau*Address: Department of Biochemistry, Bose Institute, P1/12 CIT Scheme VII M, Kolkata – 700 054,...
- 8
- 494
- 0
Báo cáo sinh học: " Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix" docx
... myristoylation of the Gag N-terminal region and subsequent targeting of the protein to the plasmamembrane. The interaction domain (I-domain) appearsto be a major region involved in Gag multimerization. The ... multimerization. The late assembly domain (L-domain) plays a critical role in pinching off of virus particles from the plasma mem-brane of infected cells. It has also been reported that inac-tivation of the ... described in A. B and D. Intensities of the bands corresponding to cell- and VLP-asso-ciated Gag in A and C were quantified using the LAS3000 imaging system (Fuji film). The efficiency of Gag-induced...
- 5
- 303
- 0
Báo cáo sinh học: "Inhibition of mitotic kinase Aurora suppresses Akt-1 activation and induces apoptotic cell death in all-trans retinoid acid-resistant acute promyelocytic leukemia cells" ppt
... in critical analysis of results.QL participated in conception and design, analysis and interpretation of data, and critical revision of the manuscript. All authors read and approved the final ... 14:719-29.14. Mazumdar A, Henderson YC, El-Naggar AK, Sen S, Clayman GL: Aurorakinase A inhibition and paclitaxel as targeted combination therapy forhead and neck squamous cell carcinoma. Head Neck ... participated in analysis and interpretation of data, and critical revision of the manuscript. SH, ZJL, JJC and ZZZ have made substantial contributionsto acquisition of data. JL and DJL participated...
- 12
- 392
- 0
Báo cáo sinh học: " Inhibition of human immunodeficiency virus type-1 (HIV-1) glycoprotein-mediated cell-cell fusion by immunor (IM28)" docx
... carried out and participated in the biologicaltests. M-Y A carried out and participated in the biologicaltests. B O carried out and participated in the biologicaltests. E M participated in ... pro-gram. Only P < 0.05 was considered significant.Authors' contributionsD M coordinated and participated in the design of the study, statistical analysis and the drafting of the manu-script. ... of syncytia formation = I.Statistical analysisData were analyzed by one-way analysis of variance(ANOVA) followed by Dunnett' test. All analyses wereperformed using the Graph-Pad Prism®...
- 6
- 382
- 0
Báo cáo hóa học: " Role of protease-activated receptor-2 on cell death and DNA fragmentation in Helicobacter pylori-infected gastric epithelial cells" ppt
... members: PAR-1, PAR-2, PAR-3 and PAR4. The co agulant protease throm bin is the physiolo-gical activator of PAR-1, PAR-3, and PAR-4. PAR-2 isactivated by multiple trypsin-like serine proteasesincluding ... Sato D, Yanaka A, Shibahara T, Matsui H, Nakahara A, Yanagawa T, Warabi E,Ishii T, Hyodo I: Peroxiredoxin I protects gastric mucosa from oxidativeinjury induced by H. pylori infection. J Gastroenterol ... celldeath and DNA fragmentation.Inhibition of PAR-2 expression suppresses H. pylori-induced activation of MAPK in gastric epithelial cellsTo determine the role of PAR-2 on the activation of MAPK,...
- 7
- 399
- 0
Báo cáo hóa học: " Deletion of human metapneumovirus M2-2 increases mutation frequency and attenuates growth in hamsters" potx
... NCRrhMPV/'M2-2/GFPpolyA:CATTTAAAT TAGTAAAAACACATCAGAGTGGGATAAATGACAatgSwa I SH startcodonM2/SH NCRdeletion in M2-2CGAAAAAATTA11 ntPoly A insertGCTAGCTTAAAAAAGTGGGACAAGTCAAA atg GTG ... ATTTAAAT TAGTAAAAACACATCAGAGT GGG ATAAATGACAatgdeletion in M2-2M2-2 stopcodon and SwaIDreading frame of GFP: ATG GTG AGC (in frame)reading frame of GFPpolyA: ATG GTG CGA AAA AAT TAA GCA ... rhMPV/GFPpolyA, an 11 nt Poly A insert wascloned into the NheI-N/P-GFP-NheI cassette using the primer 5'TGAGCTAGCTTAAAAAAGTGGGACAAGTCAAAATGGT-GCGAAAAAATTAAGCAAGGGCGAGG (hMPV P gene startsequences...
- 14
- 435
- 0
Báo cáo hóa học: " Detection of seroconversion to West Nile virus, Usutu virus and Sindbis virus in UK sentinel chickens" doc
... arrival of migratory birds from Africa, Europe and the Middle East and also being the warmest time of the year when mosqui-toes would be relatively active and therefore capable of transmitting ... 10 days old, the proportion of maternally derived neutralization positivesera against the two strains of WNV and against USUV haddropped to 2/20, 0/20 and 2/20 respectively and at days21 and ... the endpoint for individual sera. In addition we also included USUV and SINV in this analysisbecause it extended the range of viruses analysed and alsoserved as a form of internal control for...
- 6
- 359
- 0
báo cáo sinh học:" Development of a quality assurance handbook to improve educational courses in Africa" docx
... approval and reviewprocesses, support for students and staff training and welfare. It has been piloted in Ghana and the feedback was incorporated into the handbook. The handbook is currently available ... for plagiarism and collu-sion.4. Quality assurance of approval and review processesAimTo maintain the academic quality of courses and ensurethat courses remain relevant in the light of developingknowledge ... for example. The abolition of tutorials atMakerere University in Uganda was associated with a per-ceived decline in academic standards and a review recom-mended the reinstitution of tutorials...
- 5
- 488
- 0
báo cáo sinh học:" Analysis of a survey on young doctors'''' willingness to work in rural Hungary pptx
... areas rural that are not in the vicinity of a city having a medical university and/ or hav-ing a high level health care institution.This paper concentrates on potential effects of trainingon the ... hasgraduated from medical school and is spending the firsttwo years of postgraduate training in specialisation.These positions are centrally financed and offered in one of the four medical ... Budapest, the capital of Hungary. The human resources for health crisis is mainly a prob-lem in rural areas, and it is particularly severe in smalltowns and remote villages. Hospitals and clinics...
- 6
- 420
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtthe study on the effectiveness of creative writing activities in the warm up stage to motivate first year english major students at neu in integrated skills lessonsassessing the effectiveness of e customs procedures in the operations of quang ninh customs departmentthe application of a systematic disciplined and quantifiable approach to the development operation and maintenance of software that is the application of engineering to softwareexplain the concept of document object model in the context of javascriptc explain the concept of document object model in the context of javascriptemissions estimates from european countries anthropogenic em issions of pah tonnes year in the ece regionbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP